How to convert fasta file to tab delimited file

Question

I have a fasta file like

>sample 1 gene 1
atgc
>sample 1 gene 2
atgc
>sample 2 gene 1 
atgc

I want to get the following output, with one break between the header and the sequence.

>sample 1 gene 1   atgc
>sample 1 gene 2   atgc
>sample 2 gene 1   atgc

Answer 1

If you have multi-line fasta files, as is very common, you can use these scripts¹ to convert between fasta and tbl (sequence_name <TAB> sequence) format:

• FastaToTbl

  #!/usr/bin/awk -f
  {
          if (substr($1,1,1)==">")
      		if (NR>1)
                      	printf "\n%s\t", substr($0,2,length($0)-1)
      		else 
      			printf "%s\t", substr($0,2,length($0)-1)
              else 
                      printf "%s", $0
  }END{printf "\n"}
  

• TblToFasta

  #! /usr/bin/awk -f
  {
    sequence=$NF
  
    ls = length(sequence)
    is = 1
    fld  = 1
    while (fld < NF)
    {
       if (fld == 1){printf ">"}
       printf "%s " , $fld
  
       if (fld == NF-1)
        {
          printf "\n"
        }
        fld = fld+1
    }
    while (is <= ls)
    {
      printf "%s\n", substr(sequence,is,60)
      is=is+60
    }
  }
  

Save those in your $PATH, make them executable, and you can then do:

$ cat file.fa
>sequence1 
ATGCGGAGCTTAGATTCTCGAGATCTCGATATCGCGCTTATAAAAGGCCCGGATTAGGGC
TAGCTAGATATCGCGATAGCTAGGGATATCGAGATGCGATACG
>sequence2 
GTACTCGATACGCTACGCGATATTGCGCGATACGCATAGCTAACGATCGACTAGTGATGC
ATAGAGCTAGATCAGCTACGATAGCATCGATCGACTACGATCAGCATCAC
$ FastaToTbl file.fa 
sequence1   ATGCGGAGCTTAGATTCTCGAGATCTCGATATCGCGCTTATAAAAGGCCCGGATTAGGGCTAGCTAGATATCGCGATAGCTAGGGATATCGAGATGCGATACG
sequence2   GTACTCGATACGCTACGCGATATTGCGCGATACGCATAGCTAACGATCGACTAGTGATGCATAGAGCTAGATCAGCTACGATAGCATCGATCGACTACGATCAGCATCAC

And, to get the Fasta back:

$ FastaToTbl file.fa | TblToFasta
>sequence1 
ATGCGGAGCTTAGATTCTCGAGATCTCGATATCGCGCTTATAAAAGGCCCGGATTAGGGC
TAGCTAGATATCGCGATAGCTAGGGATATCGAGATGCGATACG
>sequence2 
GTACTCGATACGCTACGCGATATTGCGCGATACGCATAGCTAACGATCGACTAGTGATGC
ATAGAGCTAGATCAGCTACGATAGCATCGATCGACTACGATCAGCATCAC

This can be a very useful trick when searching a fasta file for a string:

TblToFasta file.fa | grep 'foo' | FastaToTbl

---

If you really want to keep the leading > of the header (which doesn't seem very useful), you could do something like this:

$ perl -0pe 's/\n//g; s/.>/\n>/g; s/$/\n/;' file.fa 
>sequence1 ATGCGGAGCTTAGATTCTCGAGATCTCGATATCGCGCTTATAAAAGGCCCGGATTAGGGCTAGCTAGATATCGCGATAGCTAGGGATATCGAGATGCGATAC
>sequence2 GTACTCGATACGCTACGCGATATTGCGCGATACGCATAGCTAACGATCGACTAGTGATGCATAGAGCTAGATCAGCTACGATAGCATCGATCGACTACGATCAGCATCAC

But that will read the entire file into memory. If that's an issue, add an empty line between each fasta record, and then use perl's paragraph mode to process each "paragraph" (sequence) at a time:

perl -pe  's/>/\n>/' file.fa | perl -00pe 's/\n//g; s/.>/\n>/g; s/$/\n/;'

---

¹_{Credit to Josep Abril who wrote these scripts more than a decade ago.}

Answer 2

There is a very simple BioPython solution, that is minimal, readable, and handles multi-line fasta:

from Bio import SeqIO

for record in SeqIO.parse('example.fa', 'fasta'):
    print('>{}\t{}'.format(record.description, record.seq))

Answer 3

assuming there is only one sequence line per record, use paste with two 'stdin'

cat your.fasta | paste - -

Answer 4

You can use these commands:

perl -pe 's/>(.*)/>\1\t/g; s/\n//g; s/>/\n>/g' sequences.fa | grep -v '^$'

Explanation:

1. Append a tab to every header line
2. Join all lines
3. Split the single obtained line by the '>' character
4. Remove the empty line (the first line is empty due to the fact that '>' is the first character of the FASTA file)

Answer 5

A very useful tool for this kind of data manipulation is bioawk:

$ bioawk -c fastx '{print ">"$name" "$comment"\t"$seq}' test.fa
>sample 1 gene 1    atgc
>sample 1 gene 2    atgc
>sample 2 gene 1    atgc

bioawk is based on awk, with added parsing capabilities. Here, we tell that the format is fasta or fastq with -c fastx, and this makes the $name (between ">" and the first blank character), $comment (after the first blank character) and $seq (the sequence, in one line) variables available within awk instructions.

See for instance this answer for another use case.

Answer 6

Where possible, I recommend using a dedicated parsing library, rather than hacking a parser together: as you can see in the other answers, parsing even simple formats gets complex pretty quickly if you value correctness.

Here’s a small R script that does what we need, using ‘seqinr’:

#!/usr/bin/env Rscript
suppressPackageStartupMessages(library(seqinr))
parsed = read.fasta(file('stdin'), as.string = TRUE)
table = data.frame(unlist(parsed), row.names = sapply(parsed, attr, 'Annot'))
write.table(table, stdout(), sep = '\t', quote = FALSE, col.names = FALSE)

Save it as fasta-to-tsv, make it executable, and use it as follows:

fasta-to-tsv < input.fasta > output.tsv

Equivalent code of similar length can be written in Python or Perl.

Answer 7

This could be easily done by seqkit fx2tab

seqkit fx2tab seq.fa

However, seqkit will not print the "greater than" symbol (">"). If you do need the symbol:

seqkit fx2tab seq.fa | sed 's/^/>/g'

Answer 8

Remove empty records (description without sequence):

awk '$2{print RS}$2' FS='\n' RS=\> ORS= f1.fa > f2.fa

Remove blank lines:

sed '/^$/d' f2.fa > f3.fa

Convert multi-line fasta to single-line fasta:

awk '/^>/ {printf("\n%s\n",$0);next; } { printf("%s",$0);} END {printf("\n");}' f3.fa > f4.fa

Finally, @Pierre solution:

cat f4.fa | paste - - > f.txt

Answer 9

In cases where there is no sequence wrapping and each sequence occupies only a single line, the following shell command is probably going to be fastest, easiest, and most convenient.

paste - - < your.fasta > your.new.fasta

Answer 10

Just suggested improvements to the awk scripts in @terdon's answer, using any POSIX awk:

$ cat FastaToTbl
#!/usr/bin/env bash

awk -v OFS='\t' '
    {
        if ( /^>/ ) { out = (NR>1 ? ORS : "") substr($0,2) OFS }
        else        { out = $0 }
        printf "%s", out
    }
    END { print "" }
' "${@:--}"

$ cat TblToFasta
#!/usr/bin/env bash

awk -F'\t' '
    {
        gsub(/.{60}/,"&"ORS,$2)
        sub(ORS"$","",$2)
        print ">" $1 ORS $2
    }
' "${@:--}"

$ ./FastaToTbl file.fa
sequence1       ATGCGGAGCTTAGATTCTCGAGATCTCGATATCGCGCTTATAAAAGGCCCGGATTAGGGCTAGCTAGATATCGCGATAGCTAGGGATATCGAGATGCGATACG
sequence2       GTACTCGATACGCTACGCGATATTGCGCGATACGCATAGCTAACGATCGACTAGTGATGCATAGAGCTAGATCAGCTACGATAGCATCGATCGACTACGATCAGCATCAC

$ ./FastaToTbl file.fa | ./TblToFasta
>sequence1
ATGCGGAGCTTAGATTCTCGAGATCTCGATATCGCGCTTATAAAAGGCCCGGATTAGGGC
TAGCTAGATATCGCGATAGCTAGGGATATCGAGATGCGATACG
>sequence2
GTACTCGATACGCTACGCGATATTGCGCGATACGCATAGCTAACGATCGACTAGTGATGC
ATAGAGCTAGATCAGCTACGATAGCATCGATCGACTACGATCAGCATCAC

FastaToTbl will actually work in any awk but TblToFasta requires a POSIX awk for support of regexp intervals like {60}. If you have a very old, pre-POSIX awk that doesn't support regexp intervals then get a new awk but if that's impossible for some reason then change TblToFasta to the following and then it'll also work in any awk:

$ cat TblToFasta
#!/usr/bin/env bash

awk -F'\t' '
    BEGIN {
        dots = sprintf("%"60"s","")
        gsub(/ /,".",dots)
    }
    {
        gsub(dots,"&"ORS,$2)
        sub(ORS"$","",$2)
        print ">" $1 ORS $2
    }
' "${@:--}"

Answer 11

This is an old post I have noticed and there are many offered solutions. Since it’s a frequently asked question, I thought it’s worth for me to mention that there is an overlooked tool set which contains a stand-alone program called faToTab in addition to many other useful bioinformatics tools.

faToTab inputFile.fasta outFileFasta_tab.txt

It’s a gold-chest in my opinion. Here are the links to utilities folder and details: Description and Download instructions - Binaries by machine type - Link to the github page.

Anaconda installation is:

conda install -c bioconda ucsc-fatotab
conda install -c bioconda/label/cf201901 ucsc-fatotab

Answer 12

In python I would do:

#...Suppose you have header information and 
#...sequences stored in lists

header_info1 = [elements]
header_info2 = [elements]
sequences = [sequences]
index = enumerate(sequences)
table = open(pathtoyourfile.tsv,'w+')
for h1,h2,s,i in zip(header_info1,header_info2,sequences,index):
    table.write(f">{h1}\t{h2}\t{s}\n")
    if i+1==len(sequences):
       table.write(f">{h1}\t{h2}\t{s}")
table.close()

So basically I use f strings and I iterate over these three vectors that are of the same length. At the end of the iteration, I remove new line(\n) since it won't be needed anymore since you have not to write anything further.