added 82 characters in body; edited tags
Source Link
terdon
  • 7.8k
  • 3
  • 14
  • 40

I am very new to micro RNA analysis. I have been using H. sapiens, GRCh38 + major index as given in the Bowtie Website to align with my trimmed FASTQ file . The command I am using to make very sensitive alignments with Bowtie2 is given below.

module load Bowtie2; bowtie2 --local -p 8 -q --phred33 -D 20 -R 3 -N 0 -L 8 -i S,1,0.50 -x grch38_1kgmaj -U /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.fastq -S /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.sam

module load  Bowtie2; 
bowtie2 --local -p 8 -q --phred33 -D 20 -R 3 -N 0 -L 8 \
    -i S,1,0.50 -x grch38_1kgmaj \
    -U /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.fastq \
    -S /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.sam

Then I am using samtools sort -bS 3kPa_HDF_miRNA_1bbduk.sam > 3kPa_HDF_miRNA_1bbduk.bam:

samtools sort -bS 3kPa_HDF_miRNA_1bbduk.sam > 3kPa_HDF_miRNA_1bbduk.bam

to convert samfilessam files into bam files.

However, I am hitting the error described below. [W::sam_read1_sam] Parse error at line 46371 When

[W::sam_read1_sam] Parse error at line 46371

When I grepped the specific line it shows SRR8248790.46371 4 * 0 0 * * 0 0 CCTGGATGATGATAAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGACTAGATCGGAAGAGCAC BBADAGEHIFHHIIIIIGGFIHIIIIIIIHHHHHIHHHEHEHEHFEHIIIEHIIIIIEHIIHIIIHGHHHIIII1C YT:Z:UU

SRR8248790.46371        4       *       0       0       *       *       0       0       CCTGGATGATGATAAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGACTAGATCGGAAGAGCAC   BBADAGEHIFHHIIIIIGGFIHIIIIIIIHHHHHIHHHEHEHEHFEHIIIEHIIIIIEHIIHIIIHGHHHIIII1C   YT:Z:UU

Any specific help troubleshooting this error will be very useful.

I am very new to micro RNA analysis. I have been using H. sapiens, GRCh38 + major index as given in the Bowtie Website to align with my trimmed FASTQ file . The command I am using to make very sensitive alignments with Bowtie2 is given below.

module load Bowtie2; bowtie2 --local -p 8 -q --phred33 -D 20 -R 3 -N 0 -L 8 -i S,1,0.50 -x grch38_1kgmaj -U /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.fastq -S /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.sam

Then I am using samtools sort -bS 3kPa_HDF_miRNA_1bbduk.sam > 3kPa_HDF_miRNA_1bbduk.bam to convert samfiles into bam files.

However, I am hitting the error described below. [W::sam_read1_sam] Parse error at line 46371 When I grepped the specific line it shows SRR8248790.46371 4 * 0 0 * * 0 0 CCTGGATGATGATAAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGACTAGATCGGAAGAGCAC BBADAGEHIFHHIIIIIGGFIHIIIIIIIHHHHHIHHHEHEHEHFEHIIIEHIIIIIEHIIHIIIHGHHHIIII1C YT:Z:UU

Any specific help troubleshooting this error will be very useful.

I am very new to micro RNA analysis. I have been using H. sapiens, GRCh38 + major index as given in the Bowtie Website to align with my trimmed FASTQ file . The command I am using to make very sensitive alignments with Bowtie2 is given below.

module load  Bowtie2; 
bowtie2 --local -p 8 -q --phred33 -D 20 -R 3 -N 0 -L 8 \
    -i S,1,0.50 -x grch38_1kgmaj \
    -U /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.fastq \
    -S /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.sam

Then I am using:

samtools sort -bS 3kPa_HDF_miRNA_1bbduk.sam > 3kPa_HDF_miRNA_1bbduk.bam

to convert sam files into bam files.

However, I am hitting the error described below:

[W::sam_read1_sam] Parse error at line 46371

When I grepped the specific line it shows:

SRR8248790.46371        4       *       0       0       *       *       0       0       CCTGGATGATGATAAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGACTAGATCGGAAGAGCAC   BBADAGEHIFHHIIIIIGGFIHIIIIIIIHHHHHIHHHEHEHEHFEHIIIEHIIIIIEHIIHIIIHGHHHIIII1C   YT:Z:UU

Any specific help troubleshooting this error will be very useful.

Source Link

Conversion of SAM to BAM files

I am very new to micro RNA analysis. I have been using H. sapiens, GRCh38 + major index as given in the Bowtie Website to align with my trimmed FASTQ file . The command I am using to make very sensitive alignments with Bowtie2 is given below.

module load Bowtie2; bowtie2 --local -p 8 -q --phred33 -D 20 -R 3 -N 0 -L 8 -i S,1,0.50 -x grch38_1kgmaj -U /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.fastq -S /gpfs/ycga/scratch60/nicoli/ag2646/HumanmicroRNAbowtie_verysensitive_1.06.2021./3kPa_HDF_miRNA_1bbduk.sam

Then I am using samtools sort -bS 3kPa_HDF_miRNA_1bbduk.sam > 3kPa_HDF_miRNA_1bbduk.bam to convert samfiles into bam files.

However, I am hitting the error described below. [W::sam_read1_sam] Parse error at line 46371 When I grepped the specific line it shows SRR8248790.46371 4 * 0 0 * * 0 0 CCTGGATGATGATAAGCAAATGCTGACTGAACATGAAGGTCTTAATTAGCTCTAACTGACTAGATCGGAAGAGCAC BBADAGEHIFHHIIIIIGGFIHIIIIIIIHHHHHIHHHEHEHEHFEHIIIEHIIIIIEHIIHIIIHGHHHIIII1C YT:Z:UU

Any specific help troubleshooting this error will be very useful.