I am working with an amplicon kit from Swift Bioscience and they provide the primer locations in what they call a "masterfile". The format is like this:

$ head -n2 Acel-Amplicon_56g_masterfile.txt
1       43814951        43815064        MPL_S505N-A519T_F/2     43814932        43814951        MPL_S505N-A519T_F/2_primer      43815064  43815081 MPL_S505N-A519T_R/1_primer      GCCTGGATCTCCTTGGTGA     CTTCGGCTCCACCTGGT
1       115256480       115256576       NRAS_G60-S65_new_R/1    115256457       115256480       NRAS_G60-S65_new_R/1_primer     115256576 115256602        NRAS_G60-S65_new_F/2_primer     TGATGGCAAATACACAGAGGAAG CAGGATTCTTACAGAAAACAAGTGGT

This is the format which is understood by Swift's primer clipping tool, but in order to use other tools, I would like to convert it to BEDPE. However, I can't do that since I am not sure what the fields in this file are.

This is what I think thy are:

1. Chromosome
2. Target region start
3. Target region end
4. 5' Primer name
5. 5' Primer start
6. 5' Primer end
7. 3' Primer name
8. 3' Primer start
9. 3' Primer end
10. 5' Primer sequence
11. 3' primer sequence

Is my interpretation correct? Also, is this a standard file format or something specific to the Swift tool? I couldn't find any documentation about a "masterfile" format online.

I am working with an amplicon kit from Swift Bioscience and they provide the primer locations in what they call a "masterfile". The format is like this:

$ head -n2 Acel-Amplicon_56g_masterfile.txt
1       43814951        43815064        MPL_S505N-A519T_F/2     43814932        43814951        MPL_S505N-A519T_F/2_primer      43815064  43815081 MPL_S505N-A519T_R/1_primer      GCCTGGATCTCCTTGGTGA     CTTCGGCTCCACCTGGT
1       115256480       115256576       NRAS_G60-S65_new_R/1    115256457       115256480       NRAS_G60-S65_new_R/1_primer     115256576 115256602        NRAS_G60-S65_new_F/2_primer     TGATGGCAAATACACAGAGGAAG CAGGATTCTTACAGAAAACAAGTGGT

This is the format which is understood by Swift's primer clipping tool, but in order to use other tools, I would like to convert it to BEDPE so I can then use standard tools to clip the primers from my bam files. However, I can't do that since I am not sure what the fields in this file are.

This is what I think thy are:

1. Chromosome
2. Target region start
3. Target region end
4. 5' Primer name
5. 5' Primer start
6. 5' Primer end
7. 3' Primer name
8. 3' Primer start
9. 3' Primer end
10. 5' Primer sequence
11. 3' primer sequence

Is my interpretation correct? Also, is this a standard file format or something specific to the Swift tool? I couldn't find any documentation about a "masterfile" format online.