Is there a way to extract spike sequence from a Sars-CoV-2 complete genome (preferably in Python)?

Question

I have a complete genome sequence of a Sars-CoV-2 variant, but I am only interested in the Spike sequence?

I should note that I am not a biologist (nor bioinformatics).

The complete genome looks like the following:

AAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTG
TCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACAC
GAGTAACTCGTCT...

Its length is 30230.

My question is, is there a way to know where exactly the spike sequence lies among this complete genome sequence, and if possible, are there already existing tools to extract it programmatically (in Python). Thanks in advance.

Answer 1

Spike Wuhan is here

Using Python then use the BioPython Bio.pairwise2 program here

Yours sequence is the reference, the shorter Wuhan query is the query. The genomic positions position1 and position2 will then be defined via the output of pairwise2, then cut it by using the genomic position -1 as follows:

spike = completegenome[int(position1)-1:int(position2)-1]

-1 is needed because lists start at 0 rather than 1.