1
$\begingroup$

I have this code to filter some IDs from a fasta file:

for line in file_open:
    line=line.rstrip()
    if '16S' in line:
        header=line
        header=header[0] + header[1:]
        seq=file_open.readline()
        seq=seq.strip()
        print(header + '\n'  + seq)

however, this code doesn't get me all content of each ID sequence. I get this result:

>ID1
AGTTTTGCCGAATTCCTTTAGGATTTTGTGAGGAACATTGTGTTAAATGTATTTATAGTTCTACTAATTC

When I should get this:

>ID1
AGTTTTGCCGAATTCCTTTAGGATTTTGTGAGGAACATTGTGTTAAATGTATTTATAGTTCTACTAATTC
TGCGAAGGTAGCATAATCATTAGCCTTTTGATTTGAGGCTGGAATGAATGGTTTGACGAGAGATGGTCTG
GGGCCGTGGTATACTGACCATGCGAAGGTAGCATAATCATTAGCCTCTTGATTTGAGGCTGGAATGAATG
GGGCCGTGGTATAC

Thanks

Improve this question
$\endgroup$
5
  • 4
    $\begingroup$ Does this answer your question? Remove/delete sequences by ID from multifasta $\endgroup$
    – Konrad Rudolph
    Sep 24, 2020 at 15:27
  • $\begingroup$ Well, the code you wrote prints the seq on a single line (and without any newline afterwards), are you sure that's not the only problem? $\endgroup$
    – Kamil S Jaron
    Sep 26, 2020 at 19:25
  • $\begingroup$ @KonradRudolph I think the question is more about writing the fasta file well formated. $\endgroup$
    – Kamil S Jaron
    Sep 26, 2020 at 19:25
  • 1
    $\begingroup$ @KamilSJaron No, the question isn’t about formatting. Check the output in the question again. It isn’t all on one line, it’s truncated (as in, only the first line is read and written, subsequent lines are omitted). $\endgroup$
    – Konrad Rudolph
    Sep 28, 2020 at 8:07
  • $\begingroup$ I thought that the truncated line could be due to copypasting. Now I see, it's not about the formatting of output, but expected formatting of the input. $\endgroup$
    – Kamil S Jaron
    Sep 28, 2020 at 9:06

1 Answer 1

Reset to default
8
$\begingroup$

You're assuming 2-line FASTA format, but the sequence can (and typically does) span multiple lines. You can use Biopython to build a simple parser:

from Bio import SeqIO

for record in SeqIO.parse("file_name.fa", "fasta"):
    if "16S" in record.description:
        print(record.format("fasta"))
Improve this answer
$\endgroup$
1
  • $\begingroup$ This was really helpful, thank you so much $\endgroup$
    – Sofia
    Oct 16, 2019 at 9:18

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge that you have read and understand our privacy policy and code of conduct.

Not the answer you're looking for? Browse other questions tagged or ask your own question.