2
$\begingroup$

After using files that I downloaded from the SRA with fasterq-dump, I realize I am not 100% sure that I have all the data.

I noticed in my downstream analysis that I seem to be missing the .1 and .2 numbers in the code associated with individual reads with the same spot ID. Then I noticed that my initial fastq file doesn't seem to have those either.

So I'm wondering if the -split-spot option that I used is doing what I want it do do, which is 'get all the sequence data', and how does it differ from --concatenate-reads. I am afraid I did not understand this from the program description. Please help?

$\endgroup$
2
  • $\begingroup$ Hi Laura, do you have paired-end reads? Can you provide the SRA accession too? $\endgroup$
    – StupidWolf
    Oct 24 '19 at 11:35
  • $\begingroup$ @StupidWolf It looks like they're paired. Eg. SRR6462984.63.1 and SRR6462984.63.2 . $\endgroup$
    – Laura
    Oct 24 '19 at 13:05
2
$\begingroup$

Fasterq comes from the latest version of sratools. So if you check the manual , it says the equivalence is:

fastq-dump SRRXXXXXX --split-3 --skip-technical

fasterq-dump SRRXXXXXX

In older versions of sratoolkit, if you use fastq-dump without specifying --split-3 for paired-end reads, you get the format mentioned, spotID.1 for forward, spotID.2 for reverse:

fastq-dump SRR6462984.sra
more SRR6462984.fastq

You get:

@SRR6462984.1 1 length=301
NATCTGCCCGTTCCACATAAACACCGTTAAACATCGATAGAGCGAAATAAAGCTGCTGAGTGATGTGATGATAAAGCTTTTCCGTTCTGACACGATCTTCCATCTCGTCTATCATTGCATCGAGAGCGTCAGAGATCGCAAGCAGTGCGGATATTGCCGTCCGTCTTGAAGCTTTGGCAGAGCCAGGCGGAATTTGTTTATCGGATAGTGTTTATGCGCAAATTTAGCATATGATTTCCGACAACTTTTGCTTCATCGGGCCGCAAAGCGTGAAAAACAGTGTCGTCACCGTTGATGTGTG
+SRR6462984.1 1 length=301
#/AAAEE/EEEA/EAAEEAEE/EE/EEA/EEEEE/AAE/EE/EAEAE//EEAEE/EEEEE<EEEEE/EE<EE/AEEEE/EAEEEEA/E<EEAEAEEEEEEAEEEE<EEAEEEEEAAAEEE/EEEEE/E//AEEEE6EA66EE<<<EAAA/AAAAAE/E6E/EA/AE/AEEEEEEAAEEEEA6EEEEEEEEE/EEE/AEEAAAEEEAE/E/EEEEEA//E//EEE/EEE/A<//AE/EE//6A///AA/E//E/E/EE//AE//AAEEE////E/A<AAE/EEAE//A//6/A</<6/</E/
@SRR6462984.2 2 length=302
NTCAGCAGGCGCCGTAACTTCAGCAAAACTGTAGCTATAACTTTTCCGAACTTTATACCTAACTTCGCTTTCCTAGCACTGTATAAAATGCCTAAAAGAAATCAGCAGGCGCCGTCACTTCAAAAAATCAGTATGGATCAATCAGACGCGGAGCTTATTAAAACAGAGCTTATTAAAAATTATGTCTTTCTTCTTCTTTCAGCAATTCGCAACGTAAAATTCAAAATTTTGGACGCCGTAATTGCGCAGGAACCAATTCAAAGAGGCGGCGGCCAATTAATTCCAACGTCTCGAAGAGTGGC
+SRR6462984.2 2 length=302

With the latest version, it by defaults splits the paired end sra file into forward and reverse fastq (i.e --split-3):

fasterq-dump SRR6462984.sra 
head -2 SRR6462984_*.fastq

And you get

==> SRR6462984_1.fastq <==
@SRR6462984.1 1 length=150
NATCTGCCCGTTCCACATAAACACCGTTAAACATCGATAGAGCGAAATAAAGCTGCTGAGTGATGTGATGATAAAGCTTTTCCGTTCTGACACGATCTTCCATCTCGTCTATCATTGCATCGAGAGCGTCAGAGATCGCAAGCAGTGCGG

==> SRR6462984_2.fastq <==
@SRR6462984.1 1 length=151
ATATTGCCGTCCGTCTTGAAGCTTTGGCAGAGCCAGGCGGAATTTGTTTATCGGATAGTGTTTATGCGCAAATTTAGCATATGATTTCCGACAACTTTTGCTTCATCGGGCCGCAAAGCGTGAAAAACAGTGTCGTCACCGTTGATGTGTG

So if you need to get back the .1 and .2 format, use fastq-dump from the latest installation.

I would suggest sticking to the newest format, with 2 files, because fastq-dump will be deprecated in the future.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.