3
$\begingroup$

I am mapping kmers back to a few bacterial genomes using bwa fastmap:

bwa fastmap -l 9 ref.fasta kmers.fasta > out.fastmap                                           
[M::bwa_idx_load_from_disk] read 0 ALT contigs                                                                                                                                                                     
[main] Version: 0.7.17-r1188                                                                                                                                                                                       
[main] CMD: bwa fastmap -l 9 ref.fasta kmers.fasta                                                                                                                   
[main] Real time: 0.168 sec; CPU: 0.157 sec

The output looks like this:

SQ      AAAAGTAGTAAGCAGGAAGACAACACGGTTG 31
EM      0       11      1       contig1:+2041368
EM      3       13      2       contig1:+1875252        contig1:-2474744
EM      4       15      1       contig1:+3779779
EM      5       16      1       contig1:-3253348
EM      6       17      2       contig1:+938710 contig1:+1066682
EM      7       20      1       contig1:-4912797
EM      10      21      4       contig1:+4803473        contig1:-2830252        contig1:+4495150        contig1:-4907283
EM      11      23      1       contig1:-3148132
EM      13      24      1       contig1:-4651172
EM      14      25      3       contig1:-2142223        contig1:+4994474        contig1:+873066
EM      16      26      4       contig1:+156775 contig1:+27749  contig1:+2207492        contig1:-1340811
EM      17      29      1       contig1:+3523989
EM      19      30      24      *

EM      20      31      3       contig1:-2533354        contig1:-208660 contig1:-1080177
//

My question is: what is the meaning of the * char in the row before last? Why is bwa fastmap not reporting all the hits as in the other lines? I could not find a page that explains this output anywhere.

$\endgroup$
2
$\begingroup$

Just starting to work with bwa fastmap and indeed the documentation is very sparse... This is what we get from running the program without arguments:

bwa fastmap

Usage:   bwa fastmap [options] <idxbase> <in.fq>

Options: -l INT    min SMEM length to output [17]
         -w INT    max interval size to find coordiantes [20]
         -i INT    min SMEM interval size [1]
         -L INT    max MEM length [2147483647]
         -I INT    stop if MEM is longer than -l with a size less than INT [0]

Which is a bit cryptic as is...

The output does not really follow SAM specification and I'm pretty sure the '*' means does not mean unmapped (in fact an unmapped Exact Match doesn't make any sense does it?)

In fact, the '*' means that there are too many matches to print the reference id and position. Looking quickly into the source code this is controlled by the -w arguments.

It defaults to 20, which is why you don't get an output for your 24 matches.

$\endgroup$
3
$\begingroup$

It means the read is unmapped. No origin in the reference could be found that was sufficiently similar to the read to call it a proper alignment.

In the SAM specification, * is always used if the information for that field is not available. Therefore, if no mapping information is available (=unmapped) one sets *.

$\endgroup$
0

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.