1
$\begingroup$

I know for example PolyX from Pierre's Jvarkit to find the number of repeated REF bases (homopolymers) around a position in a VCF file as described here exists.

I would like to know however if there tools that describes tandem repeats around a reported variant (TR) up to 6 repeated bases. I can imagine 3 different scenarios:

Scenario 1:

chrK    posY    C     G

TR of (ATC)
____________v
ATCATCATCATCGATGATAC

Scenario 2:

chrK    posY    A     T

             TR of (AACT)
            v____________
CAGTCGATTGGATAACTAACTAACT

Scenario 3:

chrK    posY    C     A

TR of (AG)    TR of (AG)
____________v__________
AGAGAGAGAGAGCAGAGAGAGAG

If you know any tools in mind that can be used for VCFs, I'd really appreciate citing them.

Thanks in advance.

Improve this question
$\endgroup$

2 Answers 2

Reset to default
1
$\begingroup$

The old program for doing this last updated in 2016 is Tandem Repeat Finder (TRF) here. This will not find a microsatellite sequence at a given variant, but instead find all tandem repeats in the genome and their position. It has been around for a long time.

You would then simply screen this output against the position of your variant. TRF may have been modified however to perform a search within given nucleotide boundaries.

Improve this answer
$\endgroup$
1
  • 1
    $\begingroup$ Yes I also saw that software but I didn't give it a proper test. thanks for your Answer ! $\endgroup$
    – user324810
    Feb 27, 2020 at 20:33
1
$\begingroup$

After researching a bit, I found a couple of tools that take as input BAM files. I did not test them yet:

If I find more tools, I will update this post. After testing them, I will come back to share my feedback.

Improve this answer
$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge that you have read and understand our privacy policy and code of conduct.

Not the answer you're looking for? Browse other questions tagged or ask your own question.