2
$\begingroup$

I have a sequence below from MYC gene about which I need to translate the sequence in all possible frames AND identify (for each frame) which codons are actually used in MYC

AAAGCAATAATACAATTTAAAACCTGGGTCTCTAGAGGTGTTAGGACGTG
GTGTTGGGTAGGCGCAGGCAGGGGAAAAGGGAGGCGAGGATGTGTCCGAT
TCTCCTGGAATCGTTGACTTGGAAAAACCAGGGCGAATCTCCGCACCCAG
CCCTGACTCCCCTGCCGCGGCCGCCCTCGGGTGTCCTCGCGCCCGAGATG
CGGAGGAACTGCGAGGAGCGGGGCTCTGGGCGGTTCCAGAACAGCTGCTA
CCCTTGGTGGGGTGGCTCCGGGGGAGGTATCGCAGCGGGGTCTCTGGCGC
AGTTGCATCTCCGTATTGAGTGCGAAGGGAGGTGCCCCTATTATTATTTG
ACACCCCCCTTGTATTTATGGAGGGGTGTTAAAGCCCGCGGCTGAGCTCG
CCACTCCAGCCGGCGAGAGAAAGAAGAAAAGCTGGCAAAAGGAGTGTTGG
ACGGGGGCGGTACTGGGGGTGGGGACGGGGGCGGTGGAGAGGGAAGGTTG
GGAGGGGCTGCGGTGCCGGCGGGGGTAGGAGAGCGGCTAGGGCGCGAGTG
GGAACAGCCGCAGCGGAGGGGCCCCGGCGCGGAGCGGGGTTCACGCAGCC
GCTAGCGCCCAGGCGCCTCTCGCCTTCTCCTTCAGGTGGCGCAAAACTTT
GTGCCTTGGATTTTGGCAAATTGTTTTCCTCACCGCCACCTCCCGCGGCT
TCTTAAGGGCGCCAGGGCCGATTTCGATTCCTCTGCCGCTGCGGGGCCGA
CTCCCGGGCTTTGCGCTCCGGGCTCCCGGGGGAGCGGGGGCTCGGCGGGC
ACCAAGCCGCTGGTTCACTAAGTGCGTCTCCGAGATAGCAGGGGACTGTC
CAAAGGGGGTGAAAGGGTGCTCCCTTTATTCCCCCACCAAGACCACCCAG
CCGCTTTAGGGGATAGCTCTGCAAGGGGAGAGGTTCGGGACTGTGGCGCG
CACTGCGCGCTGCGCCAGGTTTCCGCACCAAGACCCCTTTAACTCAAGAC
TGCCTCCCGCTTTGTGTGCCCCGCTCCAGCAGCCTCCCGCGACGATGCCC
CTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGT
GCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGC
AGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAA
TTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCT
CTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACA

Where should I look for all 4 pieces of information easily? Please guide.

$\endgroup$
1
  • $\begingroup$ How do you know it's MYC gene? The answer is quite dependent on it, but in general, you probably want to just align the seuqence to a genome annotation. $\endgroup$ – Kamil S Jaron Mar 15 '20 at 16:48
1
$\begingroup$

The 6-frame translation results are below you will need to do the rest. It is translated 5' to 3' but appears to contain two splice sites. You will need to use blast to resolve the start/stop of the splicing.

All 6-codon translation is available the Expasy server here. You will need to blast to resolve the splicing.


5'3' Frame 1 KAIIQFKTWVSRGVRTWCWVGAGRGKGRRGCVRFSWNR-LGKTRANLRTQP-LPCRGRPRVSSRPRCGGTARSGALGGSRTAATLGGVAPGEVSQRGLWRSCISVLSAKGGAPIII-HPPCIYGGVLKPAAELATPAGERKKKSWQKECWTGAVLGVGTGAVEREGWEGLRCRRG-ESG-GASGNSRSGGAPARSGVHAAASAQAPLAFSFRWRKTLCLGFWQIVFLTATSRGFLRAPGPISIPLPLRGRLPGFALRAPGGAGARRAPSRWFTKCVSEIAGDCPKGVKGCSLYSPTKTTQPL-GIALQGERFGTVARTARCARFPHQDPFNSRLPPALCAPLQQPPATMPLNVSFTNRNYDLDYDSVQPYFYCDEEENFYQQQQQSELQPPAPSEDIWKKFELLPTPPLSPSRRSGLCSPSYVAVTPFSLRGD 5'3' Frame 2 KQ-YNLKPGSLEVLGRGVG-AQAGEKGGEDVSDSPGIVDLEKPGRISAPSPDSPAAAALGCPRARDAEELRGAGLWAVPEQLLPLVGWLRGRYRSGVSGAVASPY-VRREVPLLLFDTPLVFMEGC-SPRLSSPLQPARERRKAGKRSVGRGRYWGWGRGRWRGKVGRGCGAGGGRRAARARVGTAAAEGPRRGAGFTQPLAPRRLSPSPSGGAKLCALDFGKLFSSPPPPAAS-GRQGRFRFLCRCGADSRALRSGLPGERGLGGHQAAGSLSASPR-QGTVQRG-KGAPFIPPPRPPSRFRG-LCKGRGSGLWRALRAAPGFRTKTPLTQDCLPLCVPRSSSLPRRCPSTLASPTGTMTSTTTRCSRISTATRRRTSTSSSSRASCSPRRPARISGRNSSCCPPRPCPLAAAPGSARPPTLRSHPSPFGET 5'3' Frame 3 SNNTI-NLGL-RC-DVVLGRRRQGKREARMCPILLESLTWKNQGESPHPALTPLPRPPSGVLAPEMRRNCEERGSGRFQNSCYPWWGGSGGGIAAGSLAQLHLRIECEGRCPYYYLTPPLYLWRGVKARG-ARHSSRREKEEKLAKGVLDGGGTGGGDGGGGEGRLGGAAVPAGVGERLGREWEQPQRRGPGAERGSRSR-RPGASRLLLQVAQNFVPWILANCFPHRHLPRLLKGARADFDSSAAAGPTPGLCAPGSRGSGGSAGTKPLVH-VRLRDSRGLSKGGERVLPLFPHQDHPAALGDSSARGEVRDCGAHCALRQVSAPRPL-LKTASRFVCPAPAASRDDAPQR-LHQQEL-PRLRLGAAVFLLRRGGELLPAAAAERAAAPGAQRGYLEEIRAAAHPAPVP-PPLRALLALLRCGHTLLPSGR 3'5' Frame 1 CLPEGRRV-PQRRRASRARSGG-GTGAGWAAARISSRYPRWAPGAAARSAAAAGRSSPPRRSRNTAAPSRSRGHSSCW-S-R-GASSREAAGAGHTKREAVLS-RGLGAETWRSAQCAPQSRTSPLAELSPKAAGWSWWGNKGSTLSPPLDSPLLSRRRT--TSGLVPAEPPLPREPGAQSPGVGPAAAEESKSALAPLRSRGRWR-GKQFAKIQGTKFCAT-RRRREAPGR-RLREPRSAPGPLRCGCSHSRPSRSPTPAGTAAPPNLPSPPPPSPPPVPPPSNTPFASFSSFSRRLEWRAQPRALTPLHKYKGGVK---GHLPSHSIRRCNCARDPAAIPPPEPPHQG-QLFWNRPEPRSSQFLRISGARTPEGGRGRGVRAGCGDSPWFFQVNDSRRIGHILASLFPCLRLPNTTS-HL-RPRF-IVLLL 3'5' Frame 2 VSPKGEGCDRNVGGRAEPGAAARGQGRGGQQLEFLPDILAGRRGLQLALLLLLVEVLLLVAVEIRLHRVVVEVIVPVGEANVEGHRRGRLLERGTQSGRQS-VKGVLVRKPGAARSARHSPEPLPLQSYPLKRLGGLGGGIKGAPFHPLWTVPCYLGDALSEPAAWCPPSPRSPGSPERKARESAPQRQRNRNRPWRP-EAAGGGGEENNLPKSKAQSFAPPEGEGERRLGASGCVNPAPRRGPSAAAVPTRALAALLPPPAPQPLPTFPLHRPRPHPQYRPRPTLLLPAFLLSLAGWSGELSRGL-HPSINTRGVSNNNRGTSLRTQYGDATAPETPLRYLPRSHPTKGSSCSGTAQSPAPRSSSASRARGHPRAAAAGESGLGAEIRPGFSKSTIPGESDTSSPPFSPACAYPTPRPNTSRDPGFKLYYCF 3'5' Frame 3 SPRREKGVTAT-EGEQSPERRLGDRGGVGSSSNFFQISSLGAGGCSSLCCCCW-KFSSSSQ-KYGCTES-SRS-FLLVKLTLRGIVAGGCWSGAHKAGGSLELKGSWCGNLAQRAVRATVPNLSPCRAIP-SGWVVLVGE-REHPFTPFGQSPAISETHLVNQRLGARRAPAPPGARSAKPGSRPRSGRGIEIGPGALKKPREVAVRKTICQNPRHKVLRHLKEKARGAWALAAA-TPLRAGAPPLRLFPLAP-PLSYPRRHRSPSQPSLSTAPVPTPSTAPVQHSFCQLFFFLSPAGVASSAAGFNTPP-IQGGCQIIIGAPPFALNTEMQLRQRPRCDTSPGATPPRVAAVLEPPRAPLLAVPPHLGREDTRGRPRQGSQGWVRRFALVFPSQRFQENRTHPRLPFPLPAPTQHHVLTPLETQVLNCIIA

$\endgroup$
2
  • $\begingroup$ thank you so much for your help. May I please ask for some more information to do this independently and confidently in future? 1. I want to stick to NCBI's tools. Is NCBI ORF finder a good tool for 6-frame translation and which parameters should I use? 2. To detect the paralogs, can you please explain the reasons behind "10,000" results and "60-80%" divergence. Also, which blast tool (blastx, tblastn etc.) should I use? 3. Can I find network of interacting proteins on KEGG ? $\endgroup$ – Mohammad Osaama Bin Shehzad Mar 15 '20 at 5:10
  • $\begingroup$ I've re-edited your question and my answer to ensure compliance with site rules. Long multipart questions fall into the category of "vagueness". Please read how the site works at bioinformatics.stackexchange.com/tour and bioinformatics.stackexchange.com/help/how-to-ask Ultimately it is orientated towards a third user identifying the answer from a off-site search engine, thus the title needs to be specific to the question $\endgroup$ – M__ Mar 15 '20 at 11:05

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.