2
$\begingroup$

I am analyzing the reads for the SARS-CoV-2 assembly with id SRR11140748. Apparently these reads were obtained with parallel sequencing by Illumina and Oxford Nanopore Technologies.

I have found these reads

GGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGAGTATGTACAAATACCTACAACTTGTGCT

As you can see, the second one has an exact copy at the tail of its beginning:

AGTATGTACAAATACCTACAACTTGTGCT

I have found other issues apparently caused by rearrangements of the virus genome, but this case seems to be different. It seems unlikely that the virus mutated in such a way and then a read was cut exactly this way. What is the most likely explanation for this read?

It's not the only one displaying the same or similar behavior. for example this other one has a copy at the tail but from bps not exactly at the beginning (CACCGGAAGCCAATATGGATC):

CAGTTACACCGGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTTACACCGGAAGCCAATATGGATC
Improve this question
$\endgroup$
2
  • $\begingroup$ Did you check if that repeated sequence perhaps corresponds to a barcoding adapter? $\endgroup$
    – Wouter De Coster
    Apr 17, 2020 at 7:59
  • $\begingroup$ I can't check that. It's not my data and I don't know what barcodes they used. But I guess if it was a barcode it would be repeated everywhere. I have made a BLAST search of some of these sequences (CACCGGAAGCCAATATGGATC for example) and they are part of the virus sequence. $\endgroup$
    – juanjo75es
    Apr 17, 2020 at 8:24

1 Answer 1

Reset to default
2
$\begingroup$

If you google AGTATGTACAAATACCTACAACTTGTGCT you'll find it's a primer sequence: https://artic.network/resources/ncov/ncov-amplicon-v3.pdf

Improve this answer
$\endgroup$
3
  • $\begingroup$ I still don't get it. Even if that is a primer I don't see how it explains it being repeated at the head and tail. $\endgroup$
    – juanjo75es
    Apr 17, 2020 at 10:02
  • $\begingroup$ I guess it means the cDNA generated in the PCR sometimes merges with another cDNA. $\endgroup$
    – juanjo75es
    Apr 17, 2020 at 10:30
  • 2
    $\begingroup$ Chimeric molecules are known to happen yes due to either PCR or the following ligation step. $\endgroup$
    – Wouter De Coster
    Apr 17, 2020 at 11:38

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge that you have read and understand our privacy policy and code of conduct.

Not the answer you're looking for? Browse other questions tagged or ask your own question.