Separate multiple sequence into different file, one sequence per file

Question

I have a file contain multiple sequence, and I want to separate them by "gene:" into different file. example:

• example.fa

  >KQK21959
  ATGGTGCTCGACCCCGTCGTCGGGGGCTCGGCCTCCCGCAAGGTCGAGCCCCTAACCCTA
  
  >KQK14546
  ATGCCTCCGCCGGACGCGGCCACCTACGCTCCCACGCTGCCAATGGCGACGTACCTCCCA
  

  • how to get results like this? one sequence per file, and after ">" is gene id, not cds id

KQK21959.fa

    >KQK21959
    ATGGTGCTCGACCCCGTCGTCGGGGGCTCGGCCTCCCGCAAGGTCGAGCCCCTAACCCTA

KQK14546.fa

    >KQK14546
    ATGCCTCCGCCGGACGCGGCCACCTACGCTCCCACGCTGCCAATGGCGACGTACCTCCCA

Answer 1

There's an app for that! The exonerate package (see here) includes a nice fastaexplode command that does exactly what you're looking for and will be much, much faster than anything we give you here since it is written in C and not a scripting language. Just install exonerate (you can do that with sudo apt install exonerate on Debian-based systems) and then:

fastaexplode file.fa

This will create these two files (file.fa is the original input file from your question):

$ ls
file.fa  KQK14546.fa  KQK21959.fa

Answer 2

A simple Biopython solution:

from Bio import SeqIO

for record in SeqIO.parse("example.fa", "fasta"):
    SeqIO.write(record, record.id + ".fa", "fasta")

Note, if you have multiple sequences with the same id, only the last sequence will be kept in the final output files

Answer 3

This can also be done using awk. This is harder to read, but probably faster than python:

awk 'sub(/^>/,""){
        FILE=$0".fa"; 
    print ">"$0 >FILE; 
        next
    }{print > FILE}' file.fa. 

This will define a new output file FILE at each header line, whose filename is the header minus the > character, suffixed with .fa. And all lines in the file are appended to the current output file.

EDIT: Changed to a faster version found on: https://crashcourse.housegordon.org/split-fasta-files.html#using-awk-instead-of-csplitsed

Answer 4

That really depends on the tools you are using. If anything will do you can use the following python snippet.

If you know that each sequence is on a single line and your file isnt gigantic use this

EDIT

Updated so the file isn't read to memory at once to address @terdon point. Although, the above solutions are probably much better.

with open( "seqs.fasta" ) as f:
    out = ""
    
    for line in f:
        if not line.strip(): continue 
        if line.startswith( ">" ):
            if not type( out ) == str: out.close()
            gene = line[1:].strip().split()[0]
            out = open( f"{gene}.fa", "w" )
            out.write( line )
            continue 
        out.write( line.strip() )
    
```