One of the advantages of paired end sequencing over single end is that it doubles the amount of data. Another supposed advantage is that it leads to more accurate reads because if say Read 1 (see picture below) maps to two different regions of the genome, Read 2 can be used to help determine which one of the two regions makes more sense. However, I don't understand how this second advantage pertains only to paired end sequencing. With single-end sequencing, couldn't you just use the read that comes right after read 1 to essentially get a longer net read?
$\begingroup$
$\endgroup$
10
asked Sep 12, 2020 at 15:15
-
$\begingroup$ An explanation for the downvote would be appreciated $\endgroup$– An Ignorant WandererSep 12, 2020 at 19:14
-
1$\begingroup$ You seem to think you can put the reads in order and they somehow join up, the reality is there is not order to the reads and it's only by assembling them like a jigsaw puzzle or aligning them to a reference genome that you can infer their location. I didn't downvote $\endgroup$– Chris_RandsSep 12, 2020 at 20:12
-
$\begingroup$ @Chris_Rands thank you for your answer. Hmm, could you elaborate more as to why there is no order? I mean, when we're obtaining the reads, aren't we starting with a primer at one end of the fragment and working our way to the other end to generate the multiple reads that make up that fragment? $\endgroup$– An Ignorant WandererSep 13, 2020 at 1:59
-
$\begingroup$ You have a picture of an Illumina read, which clearly does not work by 'working your way' from one end all the way through to the other. Why technology are you talking about that works as you suggest, and why did you post a picture of an Illumina read when it's obviously not what you are talking about? Why are you talking about multiple reads when you are asserting that there is an inherent ordering of single end reads? $\endgroup$– swbarnes2Sep 13, 2020 at 18:22
-
$\begingroup$ There isn't any "order" that could be assumed from the FASTQ file. That's why after you align reads, you often have to sort the generated SAM/BAM file. $\endgroup$– RaySep 15, 2020 at 7:48
|
Show 5 more comments
2 Answers
$\begingroup$
$\endgroup$
Like you mentioned, having read pairs can help with alignment. Your FASTQ for a single-end sequencing run will look something like this:
@SEQ_ID_0001
AGCTAGCGCGGTTGGCTTAGCGACT
+
!''*((((***+))%%%++)(%%%%
@SEQ_ID_0002
AGGTGGTTGTAGGGAAAAAAGTCTC
+
!''*((((***+))%%%++)(%%%%
...
There is not necessarily a relationship between @SEQ_ID_0001 and @SEQ_ID_0002.
They could come from neigbouring regions in the genome or they could come from different species if that's what your experiment involves.
So aligning @SEQ_ID_0001 doesn't exactly give you information about where SEQ_ID_0002 goes.
@SEQ_ID_0001 could equally map to multiple locations in the genome with the same probability.
How do we decide where it "should" go?
We can randomly distribute multi-mapped reads or do some other fancy stuff, but that usually relies on facts about the data as a whole, and not something specific to the original DNA molecule that sequencing read came from.
If we have paired-end sequencing, then like your diagram shows, you know that read 1 (R1) and read 2 (R2; these have the same @SEQ_ID) will relate to each other in some way.
@SEQ_ID_0001 R1 may be multi-mapped, but if @SEQ_ID_0001 R2 isn't, then we know that R1 should probably be relatively close to R2.
Because of how you prepare your DNA samples before sequencing, you'll have some information about the insert length distribution.
You can use this information with sequence aligners to better identify where R1 should be placed.
You can also do this if both R1 and R2 are multi-mapped; certain pairwise alignments will be more likely than others, even if the marginal alignment probabilities for each read are the same.
Finally, there are other unexpected benefits that you can get from paired-end sequencing. All of the above applies to just the mapping step, but applications like structural variant detection and chromosome conformation capture really benefit from paired-end sequencing.
If you have single-end reads for structural variant detection, then you will only detect breakpoints if the read overlaps a breakpoint. But if you have paired-end, you not only have twice the amount of DNA sequenced to look for breakpoints, you can also estimate if there is a breakpoint between the two reads (in the inner distance from your diagram) if the two reads align really far apart from each other, or on separate chromosomes. The idea is similar for chromosome conformation capture and the ligation junction sites.
$\begingroup$
$\endgroup$
In paired-end sequencing, you have an expected fragment length. So if Read 1 maps to two different places, whereas Read 2 only maps to one place. Then you can determine which one is more likely for Read 1 to map to. It cannot be too far away from Read 2 given the expected fragment length.
It is not necessarily true that paired-end sequencing gets twice the amount of data. The total amount of data can be determined when running sequencing. If single-end has 20M reads, I can just stop sequencing at 20M as well for paired-end.
