0
$\begingroup$

I got my sequencing results (bisulphite treated and non treated sequences of same species Allium cepa) and now I have to do analysis in Cymate online tool. I prepared all sequences as it is written in original Cymate paper (master sequence and clones - aligned in ClustalW, blunt ended).

My problem is that I got gaps in results (image is attached, it is from Cymate Result) on positions 27, 50, 58 etc.

enter image description here

When I looked back at my original alignment FASTA file and compared those positions, I noticed that those gaps are from C to A, or C to G transitions (and obviously Cymate outputs only C to C, and C to T cases).

Does anyone know why do I get those C to A, or C to G, are those some mismatches, should I manually remove it from alignment, or did I made some other mistake?

Any advice from you would be very useful for me!

My FASTA file alignment, which I uploaded to Cymate, is here (if anyone wants to check). First sequence is master sequence (non-treated, orifinal sequence) and the rest are clones (bisulphite treated sequences).

Consensus_cepa__(289_bp) GAAAGCCAACCACCACATCCGCCATCCCTCACAGTATGCCAACGAGCAGCTGAATGACTCCGAACAACGCAAAGCATGACGCCCAAACCGACGAACACCCAACCGAAAGGCCACAAGCGCAACGTGCATTCCAAAACCCCATGAACCACCGAATCCTGCAATGCACACCACGCTCGACGCCATTCGCTACAGACCACATCGACACGAGCGCCAAGCCATCCATCACCCGAAGCCATCCACCCACTCACAAACATACCACGAAGCACAGCAAATATGAAGACAAACCCTC
MV_A_SP6_izrezani_s_primerima__(295_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAGATAAATAA-TTAAAATAACGCAAAACATAACGCCCAAACAGACGTACTCTCAACCTAATAACCTCGAACGCAACTTACATTCAAAAACTCGATAATTCACGAAATTCTGCAATTCACACCAAA--TATTGCATTTCGCTACGTTCTTCATCGACACGAAAACCAAAATATCCATTGCCAAAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC
MV_B_SP6_izrezani_s_primerima__(295_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAGATAAATAA-TTAAAATGACGCAAAACATAACGCCCAAACAGACGTACTCTCAACCTAATGACCTTGAACGCAACTTACATTCAAAAACTCGATGATTCACGGAATTCTGCAATTCACACCAAA--TATCACATTTCGCTACGTTCTTCATCAACACGAAAACCAAAATATCCATTACCAGAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC
MV_C_SP6_izrezani_s_primerima__(291_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAAATAAATAA-TTAAAATAACGCAAAACATGACACCCAAACAGACATACTCTCAACCTAATAACCTCGAACGCAACTTACATTCAAAAACTCGATAATTCACGGAATTCTGCAATTCACACCAAA--TATCGCATTTCGCTACGTTCTTCATCGACACGAGAACCAAAATATCCATTGCCAGAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC
$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.