1
$\begingroup$

I'm using cutadapt 3.5 to trim adapters and perform some filtering on paired-end data. Both R1 and R2 sequences have 3' adapters that might be found depending on the sequence length, but R1 also has an anchored 5' adapter that I want to require for the pair to be kept in the output. For example, if that required R1 5' adapter is AAAAAAAA, the R1 3' adapter is TTTTTTTT, and the R2 3' adapter is GGGGGGGG, and I have this input:

R1:

@read1 should be kept
AAAAAAAACGTCCTGGGATTTGTAATAATATTTTAGTTCTGAGCGACAAGTAAGGGATAATTTTTTTT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@read2 should be filtered
TACCAACTACATTTAGCTTCAGGCTAGTGATGCCCGCCGTCGGCACACTGGACACATGGCTTTTTTTT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@read3 should be kept
AAAAAAAACAATTTTTACTCTAGAAATGTCTGTGCTCATCACCCCGACACCGAATAGCTATGACTCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

and R2:

@read1
AGGCTCACCGCCACTGTTGTACCTTCCTATCGCCACTCTAAGATCTATGTAACCTCTCCCGGGGGGGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@read2
TGAATAATACTGCGGTTTAATCGATATATTCGGGATTATGCAAGACACCCTACGTACTTAGGGGGGGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@read3
TACTGGAGGGTACAAGCCCGGACTATCCACGGCGTCAGCTGGCTTAGCATTGAAGGTCGGCGGTGTGT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

I'm aiming to get this R1 out:

@read1 should be kept
CGTCCTGGGATTTGTAATAATATTTTAGTTCTGAGCGACAAGTAAGGGATAA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@read3 should be kept
CAATTTTTACTCTAGAAATGTCTGTGCTCATCACCCCGACACCGAATAGCTATGACTCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

And this R2 out:

@read1
AGGCTCACCGCCACTGTTGTACCTTCCTATCGCCACTCTAAGATCTATGTAACCTCTCCC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@read3
TACTGGAGGGTACAAGCCCGGACTATCCACGGCGTCAGCTGGCTTAGCATTGAAGGTCGGCGGTGTGT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

This approach doesn't work as it discards read3:

cutadapt -a '^AAAAAAAA...TTTTTTTT' -A 'GGGGGGGG' example.R{1,2}.fastq --discard-untrimmed -o out.R1.fastq -p out.R2.fastq

I expect that's because the required/optional behavior only applies to the linked adapter for R1, and R2 is considered untrimmed for read3, which then filters the whole pair because of the default --pair-filter=any behavior (if either read is untrimmed, the pair is discarded). I found I can get the filtering I want with --pair-filter first, but then the other filtering criteria like quality and length will only apply to R1, too.

My question is, can I get the trimmed/untrimmed behavior I'm looking for (read1 and read3 trimmed, read2 untrimmed) while also applying cutadapt's filtering to both reads in each pair? In other words, can I specify to cutadapt that R1's anchored adapter is required and the other two optional, without resorting to changing the pair filter setting?

$\endgroup$
0
$\begingroup$

This is not possible in a single cutadapt call, but can be done fairly seamlessly with a pipe between two calls and with cutadapt's interleaving feature. (Thanks to the author for help with this.)


Giving the R2 3' adapter to one cutadapt command and interleaving the read pairs to piped output, a second cutadapt command can take that interleaved output and use both of R1's adapters as a linked adapter:

cutadapt -A GGGGGGGG --interleaved example.R{1,2}.fastq | \
cutadapt -a "^AAAAAAAA...TTTTTTTT" --interleaved --discard-untrimmed -o out.R1.fastq -p out.R2.fastq -

Now I can add other filters to the second call.

An additional read pair that should be filtered:

R1:

@read4 would be kept but R2 is too short
AAAAAAAACAATTTTTACTCTAGAAATGTCTGTGCTCATCACCCCGACACCGAATAGCTATGACTCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

R2:

@read4
CTACTAGACATATACCCTGGGGGGGGTTCCCCGTGAAGACGGTTACGATGTGGACAAGCACTCCAGCG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

I can now give a minimum length that applies to both in each pair:

cutadapt -A GGGGGGGG --interleaved example.R{1,2}.fastq | \
cutadapt -a "^AAAAAAAA...TTTTTTTT" --interleaved --discard-untrimmed --minimum-length 30 -o out.R1.fastq -p out.R2.fastq -

With that I get read1 and read3 in the output, as intended.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.