I am currently in the process of removing adapters and primers from some 16S data acquired, and have a conceptual question regarding this pre-processing step:
So there are a series of different primer sequences (4 for the forward and 4 for the reverse strands), as well as two adapter sequences (1 for each strand) overhanging these primers.
To test this process I am currently using cutadapt. Just to give you an example of what one of my primers vs. adapters look like:
"ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCCAGCMGCCGCGGTAA" -> fp
"ACACTCTTTCCCTACACGACGCTCTTCCGATCT" -> a1
So my question is: Given that the adapters are overhanging these primers (a1 is a an exact match with first N base pairs in fp), could we just use cutadapt once, in order to remove the primers + adapter sequences in one go?
