1
$\begingroup$

I am currently in the process of removing adapters and primers from some 16S data acquired, and have a conceptual question regarding this pre-processing step:

So there are a series of different primer sequences (4 for the forward and 4 for the reverse strands), as well as two adapter sequences (1 for each strand) overhanging these primers.

To test this process I am currently using cutadapt. Just to give you an example of what one of my primers vs. adapters look like:

"ACACTCTTTCCCTACACGACGCTCTTCCGATCTGTGCCAGCMGCCGCGGTAA" -> fp

"ACACTCTTTCCCTACACGACGCTCTTCCGATCT" -> a1

So my question is: Given that the adapters are overhanging these primers (a1 is a an exact match with first N base pairs in fp), could we just use cutadapt once, in order to remove the primers + adapter sequences in one go?

$\endgroup$

0

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Browse other questions tagged or ask your own question.