I have to manually curate some tRNA sequences in order to have their original sequence without modifications. I am getting these sequences from tRNAdb. In these sequences, I found often "_" symbols. They provide this list of symbols and "_" corresponds to insertion. My question is the insertion of what? Are they referring to a reference sequence? In the list they say that in the footnotes they provide more info. However, there are no footnotes. Have you ever had experience with tRNAdb?
Add a comment
|
2 Answers
$\begingroup$
$\endgroup$
I have BLASTed one of the tRNA sequences. Lactobacillus acidophilus, Ile, that has insertion sites.
GGGCCTATAGCTCAGCTGGTTTAGAGC_CACGCCTGATAAGCGTG_GTCGATGGTTCAAGTCCATTTAGGCCCA
It looks like insertion refers to sites that exist in reference DNA but missing from tRNA sequence. But I am not a tRNA expert, it's my interpretation. See the image.
$\begingroup$
$\endgroup$
I post the workaround that I eventually found for this problem as it could serve as a reference for the exploration of tRNAdb bioinformatic resource.
If you look at the picture, tRNAdb provides comments about the insertion symbols. Therefore, for the specified position, nucleotides are defined. The original tRNA sequences can be reconstructed from this information. Hope that this problem could be of help to the community!