0
$\begingroup$

I want to manually fold and pair two sequences (U4 and U6). And I want to make niceish figures.

I haven't found a single program that does that.

thanks

$\endgroup$
2
  • 1
    $\begingroup$ Please clarify your specific problem or provide additional details to highlight exactly what you need. As it's currently written, it's hard to tell exactly what you're asking. $\endgroup$
    – Community Bot
    Jan 22, 2023 at 23:37
  • 1
    $\begingroup$ Hi @user3392394 and welcome. The question is difficult to understand. Are you trying to perform two individual RNA structures, or is this two sequences to make a single structure? There are lots of programs for RNA structure, what I suspect is you have a specific project in mind, which is not being clearly communicated. Alternatively are you just looking for a RNA 2D structure viewer? $\endgroup$
    – M__
    Jan 22, 2023 at 23:42

2 Answers 2

1
$\begingroup$

You could try mxfold2. https://github.com/mxfold/mxfold2

% mxfold2 predict test.fa
>DS4440
GGAUGGAUGUCUGAGCGGUUGAAAGAGUCGGUCUUGAAAACCGAAGUAUUGAUAGGAAUACCGGGGGUUCGAAUCCCUCUCCAUCCG
(((((((........(((((..((((.....))))...)))))...................(((((.......)))))))))))). (24.8)
$\endgroup$
1
$\begingroup$

The RNA viewer that is particularly good is VA RNA. This stands for "Visualisation Applet for RNA". Its a java app and run it via,

java -jar /Route2Progam/vaRNA/VARNAv3-93-API.jar

Where Route2Progam is the path to where the jar files is stored, all other info in the run code is literal.

Very nice pictures, point and clicky, drag structures into different shapes and easy to colour ... so for a GUI its great.

They recommend PsuedoViewer for psuedoknots, but if that doesn't mean much ... it doesn't matter.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Not the answer you're looking for? Browse other questions tagged or ask your own question.