3
$\begingroup$

I am a student trying to analyze GEO2r datas for one of my courses. The IDs given in the output are different for different series. I need to convert all of them to a similar format.

In this process I encountered the following type of ID which I don't know its origin:

”ID"    "logFC"
"SP_v2 4634"    "-0.9897758"
"SP_v2 3382"    "-0.8391782"
"SP_v2 4210"    "-1.1693583"
"SP_v2 2117"    "-1.0504727"
"SP_v2 3488"    "-0.9756444"
"SP_v2 1128"    "-0.8289103"
"SP_v2 2735"    "-0.8629999"
...

Each one of the rows represent a single gene. My question is that what is this ID? The GEO accession is GSE97750.

$\endgroup$
  • $\begingroup$ Looks like some home made accession code, from which GEO set is it? $\endgroup$ – benn Jul 27 '17 at 11:40
  • $\begingroup$ The GEO accession is GSE97750 $\endgroup$ – hhoomn Jul 27 '17 at 12:28
  • $\begingroup$ Yeah it is a custom array. Annotation can be found in the platform (GPL22166) data table. See answer by sjockell. $\endgroup$ – benn Jul 27 '17 at 12:33
5
$\begingroup$

This is possibly a wild goose chase, but a lot of searching led me to this sample:

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM2536852

Which appears to exhibit accessions of the right format. This in turn leads to the platform:

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GPL22166

Which is a custom spotted cDNA array, which the metadata seems to suggest is a human platform.

The full annotation table gives gene symbols and Entrez IDs for most of the probes on the array:

https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?view=data&acc=GPL22166&id=53508&db=GeoDb_blob144

To take the example of the first line of your results:

ID          ORF     Entrez gene SEQUENCE
SP_v2 4634  ETNK1   55500       AAAGCAGCTTCATCTTTCAAAATTGATTTGCTCTGGTTTT

The Entrez Gene record for that ID matches up:

https://www.ncbi.nlm.nih.gov/gene/?term=55500

| improve this answer | |
$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.