2
$\begingroup$

Not sure if anyone can help me with a Racon issue as the developers are not very responsive on GitHub. I am trying to assemble a genome without a reference. I first did basecalling using dorado, then converted from bam to fastq using samtools, then trimmed using nanofilt from there I used flye for assembly and then ran minimap2 to get my sam file. For some reason when I then run Racon, I get the following error:

[racon::Polisher::initialize] loaded target sequences 0.000226 s
[racon::Polisher::initialize] loaded sequences 0.034854 s
[racon::Polisher::initialize] error: empty overlap set!

I used the following command to run the assembly:

flye --nano-raw sample_id.trimmed.fastq -o assembly -I 3 -t 4

I used the following command to run minimap2:

minimap2 -ax map-ont -t 4 sample_id.trimmed1.fastq assembly/assembly.fasta > sample_id.sam

I then used the following command to run racon:

racon -m 8 -x -8 -g -6 -w 500 -t 4 sample_id.trimmed1.fastq sample_id.sam assembly/assembly.fasta > Racon_polished.fasta

Could I please get some assistance on this issue as I am not sure what I am doing wrong. Thank you

First lines of the assembled fasta file:

>contig_1
TAACAGTGAAATTCAATGGTCTGGTATCCATCTAAACATTGAATGAGCAAGAAAAATACA

First lines of the trimmed fastq file:

@bf7e12fd-b52d-498e-9e61-39bfe2eacc80
TGTACCCTAGTGGAGAATTCACCAACGCAGCAATACCTCCGGTGTTCTGTCTACAGCGTTACTGTGTCT

First lines of the sam file:

contig_1    0   08ef4187-c2ab-4756-a269-275f6dfe99af    1   60  93179S96M1I81M1D29M1I10M2I420M1I118M1I107M1D63M1I18M4I660M2I242M CTAACTGTATTGCTGGGAAACAAATCAA
$\endgroup$
0

0

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Browse other questions tagged or ask your own question.