Fastq file with very high per base sequence quality and no box-whisker plot

Question

I have my data from NCBI. I am having difficulty making sense of and correlating my fastq file read 1 and read 2 and the fastQC report. As shown below, I have two paired-end read results each displaying 127 bp in length; however, my results on the fastQC report of per base sequence quality show 91 and it does not show the interquartile range (box-whisker plot). What could be the problem?

Below is an excerpt display of my fastq file and then the fastQC report:

@SRR20708369.1 NS500749:581:HGV7VBGXB:1:11101:17225:1048 length=127
AGCTATCACAGCANGGTACTTCCCAGCGTTACGGGANTGGCCGTACGCCTAACCGCTAACATTACTGCAGGCAACCTACTCATGCACCTAATTGGAAGCGCCACCCTAGCAATATCCACCATTAACC
+
A6AAAE6EA/AAA#EAEAEEEAEEEE/EAEEEEA<E#AAAAEEEE6E<E//EE6EAEEAEAEE/AAA6E//E/EE/A<AEEEE/AEEE//<EEA/EE/E/6<<EE<EEE/<EEEEE//<AE/AAEA/

@SRR20708369.2 NS500749:581:HGV7VBGXB:1:11101:22488:1048 length=127
AGCTATCACGCCANAAGGCTTCCGAGTTAGTATAGGNGCAAAGTGAATACATCTCTGTAACCAGACTCAGATCAAGAAATGATACATTCTGGCCAGGTGTGGTGGCTCATGCCTGTAATCTCAGCAC
+
AAAAAE/EAAAAA#EEEEEEEEEEEEEEEEEEEEE6#AA/AEA/EEEEEEEEAEEEEAEA/EAE/AEAEEA6</6E///EE//6A//AEAEE<E/EE<E<EEEEEEEEEAEAEAAE///EEE/EE6/

:

Answer 1

Cross-posted and answered on biostars: https://www.biostars.org/p/9583849/#9583850

https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&acc=SRR20708369&display=metadata is a 10x single-cell sample.

So FastQC plot you are showing us appears to be the R2 read from this sample which is 91 bp (split files, where as the example read you show above seems to be Illumina Index + R1 + R2). This is normal. Illumina index (8 bp), Read 1 is 28 bp (Cellbarcodes + UMI) and R2 is RNA (91 bp) = 127 bp.