1
$\begingroup$

I am trying to find out that which DNA sequences(in the below) have a similar domain to a specific toxin which is Clostridium botulinum

You can find the fragment of the DNA sequence that belong to that toxin gene below:

gi|27867582 (fragment of the known Clostridium botuninum toxin gene) GTGAATCAGCACCTGGACTTTCAGATGAAAAATTAAATTTAACTATCCAAAATGATGCTT ATATACCAAAATATGATTCTAATGGAACAAGTGATATAGAACAACATGATGTTAATGAAC TTAATGTATTTTTCTATTTAGATGCACAGAAAGTGCCCGAAGGTGAAAATAATGTCAATC TCACCTCTTCAATTGATACAGCATTATTAGAACAACCTAAAATATATACATTTTTTTCAT CAGAATTTATTAATAATGTCAATAAACCTGTGCAAGCAGC

I ran a blastx job over the above sequence which translates nucleotide into protein. Here's the result.

The result tells me that. The particular DNA sequence listed above, belongs to botulinum neurotoxin type E [Clostridium botulinum]

Besides, I am given two DNA sequences:

>Sequence A
TCTATCAAGTAGATTATTAAATACTACTGCACAAAATGATTCTTACGTTCCAAAATATGA
TTCTAATGGTACAAGTGAAATAAAGGAATATACTGTTGATAAACTAAATGTATTTTTCTA
TTTATATGCACAAAAAGCTCCTGAAGGTGAAAGTGCTATAAGTTTAACTTCTTCAGTTAA
TACAGCATTATTAGATGCATCTAAAGTTTATACGTTTTTTTCTTCAGATTTTATTAATAC

> Sequence B
TCCTGGCTCAGGACGAACGCTGGCGGCGTGTGCTTAACACATGCAAGTCGAGCGATGAAG
CTTCCTTCGGGAAGTGGATTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTCA
AAGTGGGGGATAGCCTTCCGAAAGGAAGATTAATACCGCATAACATAAGAGAATCGCATG
ATTTTCTTATCAAAGATTTATTGCTTTGAGATGGACCCGCGGCGCATTAGCTAGTTGGTA

Again, I translated them into proteins. The result are listed respectively(A and B):

https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&RID=Z423E71C015

https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Get&RID=Z42AKVWC015

The first job tells that, Sequence A belongs to botulinum neurotoxin type F [Clostridium baratii] which means that similar domain with the above botulinum neurotoxin>

Second job tells me that SequenceB belongs to unknown protein [Clostridium botulinum NCTC 2916]. So that means it is not in the same domain with the above botulinum neurotoxin right?

$\endgroup$
3
  • 1
    $\begingroup$ Looks like you've got two identical links for your blast searches $\endgroup$ Oct 25 '17 at 6:58
  • $\begingroup$ Ups. I edited the question. $\endgroup$
    – asd sd
    Oct 25 '17 at 14:27
  • $\begingroup$ What's a 'domain' here? Are you talking about protein domains? Domains of life? As in animals, plants, bacteria etc? What proteins were you given? You show DNA sequences here, not proteins. Please edit your question and clarify. $\endgroup$
    – terdon
    Oct 26 '17 at 8:29
1
$\begingroup$

A protein domain is a conserved part of a given protein sequence and (tertiary) structure that can evolve, function, and exist independently of the rest of the protein chain.

This is different from global protein similarity, so similarity to neurotoxin type F doesn't necessarily mean that sequence A has similar domain to your known toxin gene. Your blast results do include conserved domain information though.

$\endgroup$
3
  • $\begingroup$ The sequence B has no conserved domain, but sequenceA and first sequence (toxin gene) has one. When I click to the conserved domain information, they show the same result. That means they are in the similar domain, right? $\endgroup$
    – asd sd
    Oct 26 '17 at 19:28
  • $\begingroup$ actually, when I click "search for similar protein architectures" in Sequence A, I see the botulinum neurotoxin type E which is the protein in the original sequence. $\endgroup$
    – asd sd
    Oct 26 '17 at 19:39
  • $\begingroup$ Sounds like you have your answer $\endgroup$ Oct 26 '17 at 20:00

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.