6
$\begingroup$

There is high throughput sequencing data here, and I don't know what format it is in.

It was submitted in 2009, and the description says the following:

  • Library strategy: ncRNA-Seq

  • Library source: transcriptomic

  • Library selection: size fractionation

  • Instrument model: Illumina Genome Analyzer II

  • Description: CIPPNK, tar file of Illumina *_seq.txt files provided as supplementary file

I got the archive here:

ftp://ftp.ncbi.nlm.nih.gov/geo/samples/GSM455nnn/GSM455387/suppl/GSM455387%5FWT%5FCIPPNK%5Fseq%5Fs1%2Etar%2Egz

Inside, there are 330 files from s_1_0001_seq.txt to s_1_0330_seq.txt which are tab-delimited text files where the first column is always 1, the second has the number found in the file name, then 2 mysterious integers, and then what looks like a read of length 36, with sometimes a dot instead of a letter:

$ head s_1_0330_seq.txt 
1   330 690 785 TTCCTACATTGTTCCCCCATGCTGTTGGCACCATCA
1   330 44  145 TTTTTATCACGAGTTTTAAATCTGTAGTCACCATCA
1   330 53  141 AATAATGCATAACAAAACGGAATCTGTAGAA.AAA.
1   330 784 461 TAATTGTAGTGATTGATCAATCTGTAGGCACCATCA
1   330 588 634 TATTATGCACATTTTCTAGTTCACTGTAGGCACCAT
1   330 718 678 TTACATGTTTCGGGTAGGAGCCTGTAGGCACCATCA
1   330 635 834 TGTGATCATTAGTTCAAAGCCCCCTGTCGGCACCCT
1   330 494 523 TGAAAATCAAAAATGCTGAACTGTAGGCACCATCAA
1   330 393 783 TTTTTTTTTAAATTTAAAAAAACTGTAGGCACCATC
1   330 48  148 GTTTAACCGTGTAGACGTTGGTTTCTGTAGGCACCA

This seems to be some "old" high-throughput sequencing format. I think someone in a 2008 message in sequanswers was dealing with this type of file:

http://seqanswers.com/forums/showpost.php?p=1841&postcount=8

What is this format that seemed so standard back then, that the authors did not give more info than describing the files as "Illumina *_seq.txt files"? I do not dare ask them for such a trivial question (the given contact is a Nobel prize laureate and is probably too busy to answer random bioinformatics questions).

In particular, what are the columns 3 and 4, and what do the dots mean?

$\endgroup$
7
$\begingroup$

This is an early Solexa/Illumina sequencer format. The columns are the identifier to location on the flowcell. I believe the "." was the original placeholder for an unread base, which has been replaced by and "N" in current Illumina sequencing output.

From on http://www.crg.eu/en/content/processing-and-analysis-illumina-sequencing-data.

seq.txt (Gerald)

4 1 23 1566 ACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCG

The first 4 columns are an ID that provides location details of the cluster in the flow cell, followed by the read sequence. Seq.txt file size typically ranges between 250 Megabytes and 1 Gigabyte. One file is generated per lane.

$\endgroup$
2
  • $\begingroup$ Ah, so if the authors did not provide other files, I guess the only way I can convert this to fastq is to chose arbitrary qualities. $\endgroup$ – bli Oct 31 '17 at 15:12
  • $\begingroup$ Correct this format did not contain quality scores. There was a qseq.txt file that did. Although to be honest back then the quality scores were no that meaningful as the Illumina algorithm was not very accurate in assigning them. $\endgroup$ – Bioathlete Oct 31 '17 at 16:23

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.