4
$\begingroup$

I recently started doing the analysis on nanopore sequencing data. As I was searching for some help on pre-processing of the data, I found your nice setup pipeline created here: https://www.protocols.io/view/stranded-mapping-from-long-reads-n8cdhsw.

As I was trying to follow the instruction, I ran into a question on part where it uses lastal to divide the input file as strand specific output.

Part that uses the following script below:

lastal -P 10 ONT_barcodes_adapters.fa <(zcat 4T1_BC06.correctedReads.uniqueOnly.fasta.gz) | \  ~/scripts/maf_bcsplit.pl | grep -e 'ONT_SSP,+' -e 'ONT_VNP,-' | \   awk -F',' '{print $1}' | sort | uniq > fwdQry_seqs_BC06.txt lastal -P 10 barcodes_primerSeqs.fa <(zcat 4T1_BC06.correctedReads.uniqueOnly.fasta.gz) | \   ~/scripts/maf_bcsplit.pl | grep -e 'ONT_SSP,-' -e 'ONT_VNP,+' | \   awk -F',' '{print $1}' | sort | uniq > revQry_seqs_BC06.txt 

In here, I was wondering what the ONT_barcodes_adapters.fa file actually looks like. I wanted to find the information in other places and could not find it elsewhere.

If you could help me with this, I would really appreciate it!

$\endgroup$
1
$\begingroup$

I recommend that you look at the most recent version of the protocol, which includes example adapter and barcode files:

https://www.protocols.io/view/stranded-mapping-from-long-reads-syheft6?step=2

[check in the protocol to see if there's a more recent version]

These files contains the public sequences that ONT have released for their sequencing kits (as briefly mentioned in the "Before Starting" section of the protocol). The sequences are available on the ONT community, but I have converted them into FASTA files for use in my protocol.

The adapter and barcode files were combined into a single FASTA file in the previous version of my protocol. For the PCR cDNA barcoding, it looked something like this:

>ONT_VNP
ACTTGCCTGTCGCTCTATCTTCTTTTT
>ONT_SSP
TTTCTGTTGGTGCTGATATTGCTGCCATTACGGCCGGG
>BC01
AAGAAAGTTGTCGGTGTCTTTGTG
>BC02
TCGATTCCGTTTGTAGTCGTCTGT
>BC03
GAGTCTTGTGTCCCAGTTACCAGG
>BC04
TTCGGATTCTATCGTGTTTCCCTA
>BC05
CTTGTCCAGGGTTTGTGTAACCTT
>BC06
TTCTCGCAAAGGCAGAAAGTAGTC
>BC07
GTGTTACCGTGGGAATGAATCCTT
>BC08
TTCAGGGAACAAACCAAGTTACGT
>BC09
AACTAGGCACAGCGAGTCTTGGTT
>BC10
AAGCGTTGAAACCTTTGTCCTCTC
>BC11
GTTTCATCTATCGGAGGGAATGGA
>BC12
CAGGTAGAAAGAAGCAGAATCGGA
>RB12A
GTTGAGTTACAAAGCACCGATCAG

I separate out adapters and barcodes in the newer versions of the protocol because I was getting too many incorrect hits.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.