0
$\begingroup$

I run this cmd 

./stringtie G1_sorted.bam -B -o G1.gtf -G Triticum_aestivum.IWGSC.42.gtf -p 4  -C G1.refs.gtf -A G1.abund.tab

Error is:

-WARNING: no reference transcripts were found for the genomic sequences where reads were mapped!
Please make sure the -G annotation file uses the same naming convention for the genome sequences.

How can I resolve it?

Update:

I have downloaded both (GTF and Refernce Genome)files from Ensemble. Can you confirm me that whether theu have same chromosomes naming? So that i can perform my mapping task of GTF File with Reference Genome which usually i remain fail to do due to difference in chromosomes naming. Here The Reference genome file is shown as:

 >1A dna:chromosome chromosome:IWGSC:1A:1:594102056:1 REF
CTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCCTAACCCTAAACCCTAACCAAAAC

Where as The annotation file (gtf file ) is as 

    #!genome-build IWGSC
#!genome-version IWGSC
#!genome-date 2018-07
#!genome-build-accession GCA_900519105.1
3B      IWGSC   gene    212892  214491  .       -       .       gene_id "TraesCS3B02G000100"; gene_source "IWGSC"; gene_biotype "protein_coding";
3B      IWGSC   transcript      212892  214491  .       -       .       gene_id "TraesCS3B02G000100"; transcript_id "TraesCS3B02G000100.1"; gene_source "IWGSC"; gene_biotype "protein_coding"; transcript_source "IWGSC"; transcript_biotype "protein_coding";

Can it be confirmend that these both files are same ? If not same with chromosome naming convention , then please suggest me how can I change it ?

Improve this question
$\endgroup$
5
  • 1
    $\begingroup$ This looks like your chromosome names in the BAM don't match the GTFs you're using. Check that first. $\endgroup$
    – LucasBoatwright
    Mar 6, 2019 at 18:53
  • $\begingroup$ the reference genome download from the NCBI.and gtf file from ensembl. your mean is that i have to use the gtf file from the NCBI, then this error will be removed? $\endgroup$
    – fatima
    Mar 7, 2019 at 4:17
  • 1
    $\begingroup$ Welcome to the site @fatima. Yes ENSEMBL uses genes identifiers starting with ENSGXXXXX.XX while NCBI uses gene names with just numbers and they don't map to the same positions. They aren't exacts equivalent $\endgroup$
    – llrs
    Mar 7, 2019 at 8:35
  • $\begingroup$ hi IIrs, i have use the reference genome and gtf file from ensembl.encounter same problem.how i can mofify the file with same name? $\endgroup$
    – fatima
    Mar 9, 2019 at 18:34
  • $\begingroup$ hi @fatima (to send me a notification use @ followed by my username) Could you please explain how do you want to modify these files to use the same name? rereading again your question I find it a bit unclear what do you want to achieve and what do you expect us to do for you. $\endgroup$
    – llrs
    Mar 12, 2019 at 14:04

1 Answer 1

Reset to default
3
$\begingroup$

This seems to be a common problem. As @llrs pointed out, Ensembl, UCSC(genome browser and associated data) and NCBI records are not directly interchangeable. The ambiguity refers to annotation as well as the reference genome. The reference genome is identical, except for the chromosome naming convention, meaning a reference from Ensembl might not contain CHR prefix, whereas it will be present in one downloaded from UCSC.

To prevent such conflicts in downstream tools, it is good to stick to the reference and annotation from the same repository throughout the analysis and map the genes to gene names or whatever towards the end of the investigation.

You can download all the associated data for T. aestivum which I beleive is the organism you want to study from Ensembl plants FTP download.

Improve this answer
$\endgroup$
1
  • $\begingroup$ Hi Siddharth, Thank you, Now I have downloaded both files from Ensembl. Can you please tell me these are with the same naming? I have open the reference file.The Reference genome file is as >1A dna:chromosome chromosome:IWGSC:1A:1:594102056:1 REF CTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCCTAACCCTAAACCCTAACCAAAAC The annotation file (gtf file ) is as $\endgroup$
    – fatima
    Mar 12, 2019 at 5:10

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge that you have read and understand our privacy policy and code of conduct.

Not the answer you're looking for? Browse other questions tagged or ask your own question.