2
$\begingroup$

I am using delly to call structural variants on a human WGS sample. I noticed that it finds certain variants that are essentially duplicates. For example:

chr4    177594033       DEL00005339     G       <DEL>   .       PASS    PRECISE;SVTYPE=DEL;SVMETHOD=EMBL.DELLYv0.8.1;CHR2=chr4;END=177594095;PE=0;MAPQ=0;CT=3to5;CIPOS=-3,3;CIEND=-3,3;SRMAPQ=60;INSLEN=0;HOMLEN=3;SR=5;SRQ=0.993243;CONSENSUS=GACAAAAACATATAAACAAATACAAATTATTATTATATGAAGGGTGAAAAATTATGTTCAGCTTTAATATTATGTGGCCTGAAACAAATTTGTATAAGTCATATGATCCGTTTTGTATATTCATTAAAATAGTCATAAAAATATAAAC;CE=1.75466     GT:GL:GQ:FT:RCL:RC:RCR:CN:DR:DV:RR:RV   0/1:-51.3797,0,-42.791:10000:PASS:1115:1821:1820:1:0:0:23:27
chr4    177594033       DEL00005340     G       <DEL>   .       PASS    PRECISE;SVTYPE=DEL;SVMETHOD=EMBL.DELLYv0.8.1;CHR2=chr4;END=177594095;PE=0;MAPQ=0;CT=3to5;CIPOS=-3,3;CIEND=-3,3;SRMAPQ=60;INSLEN=0;HOMLEN=3;SR=12;SRQ=0.994186;CONSENSUS=ATATAAACAAATACAAATTATTATTATATGAAGGGTGAAAAATTATGTTCAGCTTTAATATTATGTGGCCTGAAACAAATTTGTATAAGTCATATGATCCGTTTTGTATATTCATTAAAATAGTCATAAAAATATAAACAATGTAATAAGTATGTTTGAATAGTATTATGAT;CE=1.72637    GT:GL:GQ:FT:RCL:RC:RCR:CN:DR:DV:RR:RV   0/1:-51.3797,0,-42.791:10000:PASS:1115:1821:1820:1:0:0:23:27

The two variants above have the same start position and the same end position (END=177594095). However, they differ in the SR, SRQ and CONSENSUS fields. These are defined in the VCF header as:

##INFO=<ID=SR,Number=1,Type=Integer,Description="Split-read support">
##INFO=<ID=SRQ,Number=1,Type=Float,Description="Split-read consensus alignment quality">
##INFO=<ID=CONSENSUS,Number=1,Type=String,Description="Split-read consensus sequence">

Of course, the consensus sequences are quite similar, but they aren't identical (I have simply added some spaces to the beginning of the 2nd sequence here to align them):

GACAAAAACATATAAACAAATACAAATTATTATTATATGAAGGGTGAAAAATTATGTTCAGCTTTAATATTATGTGGCCTGAAACAAATTTGTATAAGTCATATGATCCGTTTTGTATATTCATTAAAATAGTCATAAAAATATAAAC
         ATATAAACAAATACAAATTATTATTATATGAAGGGTGAAAAATTATGTTCAGCTTTAATATTATGTGGCCTGAAACAAATTTGTATAAGTCATATGATCCGTTTTGTATATTCATTAAAATAGTCATAAAAATATAAACAATGTAATAAGTATGTTTGAATAGTATTATGAT

So what am I looking at here, exactly? If this is a deletion on chromosome 4 from position 177594033 to position 177594095, then how can the length of the consensus sequence be different? This is the "split read consensus", so presumably the sequence that appears to have been deleted based on how the reads covering that region are split. This means that these reads align to the genome with a gap and this gap indicates the deletion (image source):

split read example

Therefore, if the start and end position are the same, the consensus should also be identical. And, in any case, if the start and end positions are the same, then this should be the same structural variant, so why is it being reported twice? How can I interpret this result?

$\endgroup$
1
$\begingroup$

It turns out that this was just a bug which has been fixed by this commit. The current master version of delly no longer exhibits this behavior.

If you are facing this issue, either build the current master version or wait a bit for the next release which should also include this fix.

$\endgroup$

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Not the answer you're looking for? Browse other questions tagged or ask your own question.