3
$\begingroup$

I'm currently analyzing two samples of eosinophil cells isolated from mouse lung and the samples are of very different quality.
According to the Cell Ranger summary 56% of the reads can be mapped to the transcriptome in the first sample and only 32% in the second sample. Also the number of cells identified in Cell Ranger are very differnt (5000 for sample 1 and 600 for sample 2).

When I look at the raw data in FastQC I see that the second sample has a lot of poly-A sequences in the R2 read that obviously can't be mapped to the transcriptome.

Sample 1:
per base sequence content sample 1

Sample 2: per base sequence content sample 2

Also in many cases there is the following sequence in front of the poly-A:
AAGCAGTGGTATCAACGCAGAGTACATGGG

To me it looks as if most of the reads do not contain an insert and are primer dimers. Is this connected to the lower cell count in the second sample?
Maybe some of you have already seen something like this and have a suggestion on how to avoid such a problem in the future.

Thanks a lot

$\endgroup$
  • $\begingroup$ Perhaps it's an insert size issue. Can you get the post library construction QC info? You might also see this in the BAMs, with the first showing a full bell-shaped peaks, and the latter truncating the peaks at the cleavage site. (Most 10X datasets I've seen have very few reads traversing the 3' end cleavage site.) $\endgroup$ – merv Nov 24 '19 at 4:22

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy

Browse other questions tagged or ask your own question.