Questions tagged [alignment]

These questions are about sequence alignment.

Filter by
Sorted by
Tagged with
1 vote
1 answer
39 views

Perform protein structure-based sequence alignment in Python

I am looking for a Python package that performs pairwise structural alignment of protein structures (i.e., PDB files) and returns a sequence alignment. PyMOL is able to do this through the GUI, for ...
user avatar
1 vote
1 answer
25 views

how to create "sample file" for the qAlign() function after trimming the reads in R

I'm an absolute beginner trying to solve this question "Align the trimmed and untrimmed reads using QuasR and plot alignment statistics, did the trimming improve alignments?" I did trim the ...
user avatar
  • 21
1 vote
2 answers
38 views

Phylogenetic tree building from proGenomes database for shotgun metagenomics

For some weeks I'm fighting with an issue about phylogenetic tree building to use in a phyloseq object in order to calculate beta-diversity metrics that takes into account phylogenetic distance. I’m ...
user avatar
  • 41
1 vote
1 answer
35 views

Select synonymous sites from a multiple sequence alignment

Could someone kindly recommend a tool or R package that can identify synonymous sites in a multiple sequence alignment? I wish to select those taxa for tree reconstruction and other downstream ...
user avatar
  • 11
2 votes
1 answer
71 views

Sequence alignment with MUSCLE

For protein multiple sequence alignment (MSA), I am using MUSCLE (v5.1). The default setting without any specifications gives a 'bad' output even though my proteins are very similar (UniProt sequence ...
user avatar
3 votes
1 answer
94 views

BWA mem | samtools view: Intermittent parsing error

Update The issue was that bwa was running out of memory and failing, but that error wasn't floating to the top (see @Steve's answer, below). I was getting an error ...
user avatar
  • 1,234
3 votes
2 answers
347 views

Hirschberg's Alignment Algorithm Implementation. Works on the wiki example but not on large sequences of dissimilar size

I implemented Hirschberg's algorithm in python and used the wiki example to verify correct implementation given the scoring parameters and sequences: ...
user avatar
2 votes
1 answer
69 views

Samtools sort: most efficient approach to sort a single sample after aligning split .fastq files

Related to my other question (Samtools sort: most efficient memory and thread settings for many samples on a cluster), we need to optimize samtools sort as we ...
user avatar
  • 1,234
0 votes
0 answers
20 views

Why does Nucmer Genome alignment produce faulty Dot plot?

I am using Mummer v.3.23 to make a dot plot between two genomes of the same species. One genome was assembled using PacBio and one from Dovetail. None of them is ...
user avatar
2 votes
1 answer
71 views

bowtie No alignments

This question was also asked on Biostars I am working on miRNA alignment using bowtie. But it seems to fail to map. Here are the commands: ...
user avatar
1 vote
4 answers
160 views

Remove gaps from alignment?

I have an MSA (protein sequence) and I have used various programmes (Clustal, Aliview, MEGA11 etc) to align. However, in all programmes I get many gaps which is not ideal as I am trying to construct a ...
user avatar
  • 85
1 vote
1 answer
73 views

Why does BWA MEM orientation contradict my library prep method

I have some RNA-seq data from a stranded paired end library prep, with dUTP and UDG preparation, so the orientation should be RF (confirmed with sequencing provider). I assembled the reads with ...
user avatar
  • 347
0 votes
0 answers
14 views

Global vs Local alignment scoring matrix

When creating scoring matrices for global and local alignments is there are difference regarding the "highest score of the matrix". For example, for the two matrices below, the correct ...
user avatar
  • 103
1 vote
0 answers
72 views

How to convert the chromosome position for insertions/deletions to rsIDs in a GWAS summary statistics?

I am trying to convert chromosome positions to rsIDs of a GWAS summary statistics file. I used bedtools intersect to merge the reference genome GRCh37 and the ...
user avatar
  • 11
0 votes
0 answers
18 views

Type and number of gaps in sequence alignments

I used Kalign and Muscle to align given sequences, the results are presented below. My question is, based on the two alignments which tool seems better? I would personally believe that the Muscle tool ...
user avatar
  • 103
2 votes
1 answer
33 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
user avatar
  • 249
0 votes
1 answer
21 views

How do you search for new enzymes that are more stable for handling, immobilization?

Noob here. I get that I should deduce what characteristics the ideal new enzyme should meet, and then use tools such as PDB and blast to compare to the old enzymes, and use other tools such as pymol, ...
user avatar
2 votes
0 answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
user avatar
  • 145
4 votes
1 answer
56 views

use Kallisto in galaxy

I want to use Kallisto for sequence alignment in Galaxy. Its description is: a program for quantifying abundances of transcripts from bulk and single-cell RNA-Seq data, or more generally of target ...
user avatar
  • 63
0 votes
1 answer
26 views

Total pairs of amino acid substitution

I am reading a blog and it says: The numbers for identities and replacements used for calculating the overall alignment score in the expression above are usually presented in the form of a 20 x 20 ...
user avatar
  • 115
1 vote
1 answer
90 views

where to find sample contig data

Where or How can I find contigs? I am trying to learn Bioinformatics and I want to make a reference-based gene search. I also want to align contigs with a given reference sequence. From NCBI other ...
user avatar
  • 73
1 vote
1 answer
53 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
user avatar
  • 149
2 votes
1 answer
42 views

Understanding ViennaRNA RNAdistance scoring table

I'm trying to compare the output of 2 different algorithms of RNA structure prediction (my implementation of Nussinov vs RNA-mfold algorithm) using the RNAdistance algorithm that is part of ViennaRNA ...
user avatar
  • 141
2 votes
2 answers
227 views

Calculate genome coverage and depth from alignment

I have a .bam alignment file and a genome reference .fasta file. I am looking for a easy to use tool (that I can reference in a publication) to calculate the percentage coverage of the reference by ...
user avatar
0 votes
1 answer
461 views

STAR aligner multiple fastq files

I’m using STAR to align fastq files from SMART-seq2. I have raw data folder containing sub-folders with samples names the sub-folders each contain fastq file. How can I make a bash command in order ...
user avatar
1 vote
1 answer
71 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
user avatar
  • 149
2 votes
1 answer
96 views

Global alignment between two sequence X and Y with maximum number of identical matches

If 2 protein sequence X of length m and Y of length n and if there are several highest scoring global alignments, then I want to get one alignment that has largest number of columns in which a letter ...
user avatar
  • 21
0 votes
1 answer
73 views

Supplementary aligments in VAF

This question has also been asked on Biostars I have a doubt, are supplementary alignment usually considered when the variant allele frequency is calculated? Thanks a lot. In my case I have some ...
user avatar
1 vote
1 answer
211 views

Assessing PyMol sequence alignment object

I use cealign in PyMol for structure alignment. Instead of visualization, I want to return the alignment object to my python script for further analysis. Is there a function to return the object ...
user avatar
  • 175
1 vote
1 answer
32 views

Measure the purifying selection for certain taxa along a phylogeny

I am posting this message because I need clarity about the analysis I want to perform. In my analysis, I have a homologous gene in 13 species, and I would like to evaluate the selection pressure of ...
user avatar
0 votes
2 answers
49 views

What programs account for structural alignment of different parts of distant homologs which have significant structural differences?

If there is a need to perform structural alignment of different parts of distant homologs, which program one should use? Since distant homologs often have significant structural changes, meaning the ...
user avatar
  • 21
0 votes
1 answer
213 views

TopHat2 versus HISAT2 inner workings

In my intro to bioinformatics course, we mentioned that TopHat2 and HISAT2 will both try to align as many reads as possible to the reference genome (TopHat2 has been superseded by HISAT2). For the ...
user avatar
1 vote
0 answers
31 views

BAM file filteing to remain best isoform

I ran HiSat2, MarkDuplicate, removed reads with the lower quality score than 40 and finally only kept properly paired reads. After the BAM filtering steps, I used the Scallop results with TransDecoder....
user avatar
0 votes
1 answer
36 views

Installation of PRANK MSA in WLS Ubuntu 20.04 LTS

I want to install PRANK on the Windows 10 Linux subsystem (Ubuntu 20.04 LTS), I have followed the installation instructions to no avail. ...
user avatar
  • 3
1 vote
1 answer
124 views

why in RNA seq don't we only use reference transcriptome?

I would like to ask why in RNA seq analysis (alignment step) we use sometimes reference genome instead of reference transcriptome? thank you!
user avatar
  • 101
1 vote
0 answers
24 views

What are the symbols of $*$ and '$\_$' in an unknown alignment format for HLA data from the IMGT dataset?

Has anyone worked with the IMGT HLA database/dataset before? IMGT-HLA git repo they have some convenient text files (eg. link to gene A .txt file) with the genomic data for the different alleles of ...
user avatar
  • 178
3 votes
1 answer
408 views

Difference between genome assembly and genome sequence alignment to a reference to find structural variants

I'm trying to determine what the difference and benefits of genome assembly and genome sequence alignments are when trying to identify structural variants or transposons in populations. I've been ...
user avatar
  • 31
0 votes
1 answer
53 views

Display a score or graph to visualize the degree of conservation of each residue from alignment data

I would like to display a score or graph to visualize the degree of conservation of each residue from the amino acid alignment data. If possible, I'd like to extract the parts of the game that scored ...
user avatar
2 votes
1 answer
384 views

How to extract unmatched reads using bwa and samtools?

I have a single read (NOT paired) that I need to pass through the workflow described in Beauclair et al. paper (free version here https://rnajournal.cshlp.org/content/24/10/1285.long) for identifying ...
user avatar
0 votes
1 answer
371 views

Can't align 2 sequences, (MAFFT killed)

I have 2 .fa sequenes like: ...
user avatar
  • 101
2 votes
1 answer
32 views

which is the right prosite pattern?

I would like to ask if the right Prosite pattern for this multiple alignment: Is it this: A-T-[AT]-G-x-C-[AGC]-C-x(1,4)-A or this: ...
user avatar
  • 101
0 votes
1 answer
173 views

How to calculate mutation rate and mutation sites in a genome using FASTA file?

I have 6 viral genome sequences of the same virus and 1 reference sequence in FASTA format. How I can identify mutations and mutation sites in those genomes using FASTA sequences but how I can do ...
user avatar
  • 75
2 votes
0 answers
80 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
user avatar
  • 206
0 votes
1 answer
102 views

Why use Needleman-Wunsch if there is no way to evaluate the statistical significance

I thought that Needleman-Wunsch is the best approach to align sequences. However, I read that it is impossible to evaluate the statistical significance of the alignment if you do global alignment. So ...
user avatar
  • 101
1 vote
1 answer
100 views

merge the matrix from computematrix of deeptools

I have several matrix from computematrix of deeptools. I need to merge two of them using "computeMatrixOperations cbind -m input1.mat.gz input2.mat.gz -o output.mat.gz" but I am running to error "/...
user avatar
  • 95
1 vote
0 answers
120 views

How can I interpret multiple alignment results?

I would like to ask how I can interpret objectively multiple alignment results. I have used JALVIEW and TCOFFEE. I would like to ask if consistency score plays any role in the interpretation? I ...
user avatar
  • 101
1 vote
1 answer
155 views

What's the meaning of having different alignments with the same qname in a bam with no duplicates?

I have removed duplicates from my bam file (not secondary, nor suplementary alignments), and then I have looked for some repeated qnames (to assess the failure of a ...
user avatar
  • 135
3 votes
1 answer
136 views

Chromosomal order of supplementary alignment in BAM file "SA" tag

I have several long-read sequences, which when aligned to a human reference genome, aligns to multiple chromosomal fragment as a result of chromothripsis shattering the linear DNA and randomly piecing ...
user avatar
1 vote
2 answers
309 views

Extract end position from CIGAR

I was wondering how could I obtain the end position of an alignment using its start position and its CIGAR String. If an alignment present some soft clipping, for example: ...
user avatar
  • 135
1 vote
0 answers
46 views

Unmapping Alternative reads in BAM file

I want to do some HLA typing, most of the tools require the bam file is aligned to primary genome without alternative read handling. From the International Genome Sample Resource project, I can get ...
user avatar