Questions tagged [alignment]

These questions are about sequence alignment.

30 questions with no upvoted or accepted answers
Filter by
Sorted by
Tagged with
9
votes
1answer
191 views

Chimera Alignments

I have a structure with two subunits. I am trying to show movement of the C-terminal subunit upon ligand binding by superposition with another structure from the same strain in the apo form. I want ...
4
votes
1answer
72 views

Is there a modern alignment tool tailored for transmembrane regions?

I am looking for a project or tool that allows programmatic pairwise alignments of proteins but that takes care with transmembrane regions of proteins. TM regions are traditionally too information ...
4
votes
0answers
142 views

convert supplementary reads to primary in sam or bam

I have a problem with a tool, that possibly ignores supplementary reads. I want to find out a bit how this tool works by converting all supplementary reads to primary reads, and then change the names ...
4
votes
0answers
168 views

R Biostrings pairwiseAlignment to BAM

The R package Biostrings has a function to create a pairwiseAlignment from pattern and subject sequences. So far I can save the result into a text file using writePairwiseAlignments. I would like to ...
3
votes
0answers
58 views

Trying to show the gaps of each seq on bio::Graphics after converting clustalw

I want a box representing each sequence, positioned as they are in the alignment and with gaps shown as breaks in the each box. I've been having trouble for a while with this and have been trying to ...
2
votes
0answers
25 views

use Kallisto in galaxy

I want to use kalisto for sequence alignment in Galaxy. i found this field empty: there is no option available for the reference transcriptome. how I can get one? Can I let the other configuration by ...
2
votes
1answer
178 views

Read alignment using Bowtie2

So this is related to CRISPR-CAS9. I am working with off-target predictions for my thesis and was looking at all scientific papers related to CRISPR. I found one and decided to use their datasets. The ...
2
votes
0answers
31 views

Alignment using secondary and tertiary features of DNA

I m trying to align different sequences of length not greater than 50 bp. Could I incorporate additional information such as stacking energy, entropy, bonds etc as additional criteria in the alignment?...
2
votes
0answers
106 views

aligner for 1D^2 oxford nanopore data

I am wondering if anyone has tried aligning 1d^2 RNA-seq data. I am trying that on minimap2. It is giving me very low ~50% of mapped reads. it gives ~95% mapped reads for 1D. I am using the following ...
1
vote
0answers
45 views

How to convert the chromosome position for insertions/deletions to rsIDs in a GWAS summary statistics?

I am trying to convert chromosome positions to rsIDs of a GWAS summary statistics file. I used bedtools intersect to merge the reference genome GRCh37 and the ...
1
vote
0answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
1
vote
0answers
31 views

BAM file filteing to remain best isoform

I ran HiSat2, MarkDuplicate, removed reads with the lower quality score than 40 and finally only kept properly paired reads. After the BAM filtering steps, I used the Scallop results with TransDecoder....
1
vote
0answers
24 views

What are the symbols of $*$ and '$\_$' in an unknown alignment format for HLA data from the IMGT dataset?

Has anyone worked with the IMGT HLA database/dataset before? IMGT-HLA git repo they have some convenient text files (eg. link to gene A .txt file) with the genomic data for the different alleles of ...
1
vote
0answers
75 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
1
vote
0answers
99 views

How can I interpret multiple alignment results?

I would like to ask how I can interpret objectively multiple alignment results. I have used JALVIEW and TCOFFEE. I would like to ask if consistency score plays any role in the interpretation? I ...
1
vote
0answers
43 views

Unmapping Alternative reads in BAM file

I want to do some HLA typing, most of the tools require the bam file is aligned to primary genome without alternative read handling. From the International Genome Sample Resource project, I can get ...
1
vote
0answers
218 views

bedtools coverage - Report the depth at each position in each A feature

I am using bedtools coverage to compute the sequencing depth at every positions of a chromosome but it didn't work as I expected. Instead it reported 0 coverage at every positions. This is how I did ...
1
vote
0answers
368 views

Aligning nucleotide sequences in APE software

I am very new to APE software. I am trying to align complementary oligo-DNA strands using APE on macOS. I have both the forward and reverse sequence of an oligo-DNA insert in two separate files. But I ...
1
vote
0answers
15 views

Finding the conserved region of protein in a given set of Kingdom

We have to find the conserved region of proteins in a given set of kingdom and we have to give more weightage to distantly related organism. What approach I should take to solve this problem?
1
vote
0answers
28 views

Stand alone chaining tool for existing blast hits?

I have a table of blast hits in a database that I'd like to chain. What is a good choice for a 'stand alone' chaining tool? Is it simple to implement in Perl, for example? Example 'hit' data is here. ...
1
vote
0answers
42 views

How can I determine a mean sequence divergence for 10k sequences?

I am trying to analyze a number of repetitive sequences and as one step want to calculate a sequence divergence between the elements I found. Now in theory I wanted to generate a MSA of the sequences ...
1
vote
0answers
90 views

Mugsy error: Can't find species II dna at output/software/mugsy_x86-64-v1r2.3/mugsy line 501

I have installed mugsy in order to create a multiple genome alignment and a phylogenetic tree of several species of nematodes. The following command successfully pulls out the help: ...
1
vote
0answers
171 views

igv_plotter error: Xvfb did not start

I am trying to get screenshots from alignments of reads to a genome in IGV (Integrated Genome Viewer) using igv_plotter. ...
1
vote
0answers
140 views

Can Mauve export indels or is there an whole-genome aligner that can export indels?

I have aligned two whole genomes of the same species in Mauve using progressiveMauve. One of the genomes is 2 megabases longer than the other so I know it must contain some insertions. Looking at the ...
1
vote
1answer
34 views

bowtie No alignments

This question was also asked on Biostars hi all, I am working on miRNA alignment using bowtie. But it seems to fail to map. Here are the commands: ...
0
votes
0answers
11 views

Why does Nucmer Genome alignment produce faulty Dot plot?

I am using Mummer v.3.23 to make a dot plot between two genomes of the same species. One genome was assembled using PacBio and one from Dovetail. None of them is ...
0
votes
0answers
13 views

Global vs Local alignment scoring matrix

When creating scoring matrices for global and local alignments is there are difference regarding the "highest score of the matrix". For example, for the two matrices below, the correct ...
0
votes
0answers
18 views

Type and number of gaps in sequence alignments

I used Kalign and Muscle to align given sequences, the results are presented below. My question is, based on the two alignments which tool seems better? I would personally believe that the Muscle tool ...
0
votes
1answer
17 views

How do you search for new enzymes that are more stable for handling, immobilization?

Noob here. I get that I should deduce what characteristics the ideal new enzyme should meet, and then use tools such as PDB and blast to compare to the old enzymes, and use other tools such as pymol, ...
0
votes
0answers
26 views

How to build ML tree among OTUs and 16s sequence

I have OTUs sequence generated from 16s V4 clean reads, and want to build maximum likelhood tree with selcted taxonomy 16s refseq from Sliva database. ...