Questions tagged [alignment]

These questions are about sequence alignment.

Filter by
Sorted by
Tagged with
-1
votes
1answer
24 views

bowtie No alignments

This question was also asked on Biostars hi all, I am working on miRNA alignment using bowtie. But it seems to fail to map. Here are the commands: ...
1
vote
4answers
42 views

Remove gaps from alignment?

I have an MSA (protein sequence) and I have used various programmes (Clustal, Aliview, MEGA11 etc) to align. However, in all programmes I get many gaps which is not ideal as I am trying to construct a ...
1
vote
1answer
47 views

Why does BWA MEM orientation contradict my library prep method

I have some RNA-seq data from a stranded paired end library prep, with dUTP and UDG preparation, so the orientation should be RF (confirmed with sequencing provider). I assembled the reads with ...
18
votes
2answers
9k views

Obtaining uniquely mapped reads from BWA mem alignment

This is based on a question from betsy.s.collins on BioStars. The original post can be found here. Does anyone have any suggestions for other tags or filtering steps on BWA-generated BAM files that ...
0
votes
1answer
15 views

How do you search for new enzymes that are more stable for handling, immobilization?

Noob here. I get that I should deduce what characteristics the ideal new enzyme should meet, and then use tools such as PDB and blast to compare to the old enzymes, and use other tools such as pymol, ...
1
vote
0answers
74 views

How to change sequence format in my alignment file?

I have fasta file with alingned several sequences (from MUSCLE), when I open it (e.g. notepad++) they look like: And I want dot format of identities like and then save it in txt file. I failed ...
1
vote
1answer
45 views

Given a multiple sequence alignment, how do I output all of the non-consensus characters by location?

I have an MSA from MAFFT (as a FASTA file; there are several sequences in the MSA), and I would like to quantify the "variants" between these sequences. What is the standard tool to do ...
0
votes
0answers
13 views

Global vs Local alignment scoring matrix

When creating scoring matrices for global and local alignments is there are difference regarding the "highest score of the matrix". For example, for the two matrices below, the correct ...
1
vote
0answers
33 views

How to convert the chromosome position for insertions/deletions to rsIDs in a GWAS summary statistics?

I am trying to convert chromosome positions to rsIDs of a GWAS summary statistics file. I used bedtools intersect to merge the reference genome GRCh37 and the ...
2
votes
1answer
26 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
0
votes
0answers
18 views

Type and number of gaps in sequence alignments

I used Kalign and Muscle to align given sequences, the results are presented below. My question is, based on the two alignments which tool seems better? I would personally believe that the Muscle tool ...
4
votes
1answer
72 views

Is there a modern alignment tool tailored for transmembrane regions?

I am looking for a project or tool that allows programmatic pairwise alignments of proteins but that takes care with transmembrane regions of proteins. TM regions are traditionally too information ...
9
votes
1answer
182 views

Chimera Alignments

I have a structure with two subunits. I am trying to show movement of the C-terminal subunit upon ligand binding by superposition with another structure from the same strain in the apo form. I want ...
1
vote
0answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
0
votes
1answer
119 views

How should I deal with segmental duplications when aligning NGS reads to a reference genome?

This is a follow-up of my other question. I have been having trouble calling variants in the human SMN1 and SMN2 genes, because the human genome has a large segmental duplication there and these two ...
1
vote
1answer
168 views

Read alignment using Bowtie2

So this is related to CRISPR-CAS9. I am working with off-target predictions for my thesis and was looking at all scientific papers related to CRISPR. I found one and decided to use their datasets. The ...
2
votes
2answers
113 views

Calculate genome coverage and depth from alignment

I have a .bam alignment file and a genome reference .fasta file. I am looking for a easy to use tool (that I can reference in a publication) to calculate the percentage coverage of the reference by ...
3
votes
0answers
126 views

How to assign the best gap penalty and gap extension penalty using BLOSUM65 [closed]

For an assignment I must do a pairwise optimal local alignment using BLOSUM65 and five protein sequences. The algorithm I want to use is the Smith-Waterman. Context protein sequencing using Blastp: ...
4
votes
0answers
165 views

R Biostrings pairwiseAlignment to BAM

The R package Biostrings has a function to create a pairwiseAlignment from pattern and subject sequences. So far I can save the result into a text file using writePairwiseAlignments. I would like to ...
3
votes
0answers
58 views

Trying to show the gaps of each seq on bio::Graphics after converting clustalw

I want a box representing each sequence, positioned as they are in the alignment and with gaps shown as breaks in the each box. I've been having trouble for a while with this and have been trying to ...
3
votes
1answer
50 views

RNASeq read coverage in protein space?

I used samtools depth to find the per base-pair read coverage over a number of isoform contigs from my Trinity assembly. I have also conducted a multiple sequence ...
2
votes
0answers
22 views

use Kallisto in galaxy

I want to use kalisto for sequence alignment in Galaxy. i found this field empty: there is no option available for the reference transcriptome. how I can get one? Can I let the other configuration by ...
2
votes
1answer
73 views

Global alignment between two sequence X and Y with maximum number of identical matches

If 2 protein sequence X of length m and Y of length n and if there are several highest scoring global alignments, then I want to get one alignment that has largest number of columns in which a letter ...
0
votes
1answer
17 views

Total pairs of amino acid substitution

I am reading a blog and it says: The numbers for identities and replacements used for calculating the overall alignment score in the expression above are usually presented in the form of a 20 x 20 ...
1
vote
1answer
45 views

where to find sample contig data

Where or How can I find contigs? I am trying to learn Bioinformatics and I want to make a reference-based gene search. I also want to align contigs with a given reference sequence. From NCBI other ...
3
votes
1answer
154 views

Glocal\semi-local\Hybride Globale-Local alignment with Python

I was looking for a simple way to do a glocal alignment. The case I have is I have a small sequence which should be find in a bigger one, thus typically a glocal alignment. Also I can not Install ...
4
votes
0answers
137 views

convert supplementary reads to primary in sam or bam

I have a problem with a tool, that possibly ignores supplementary reads. I want to find out a bit how this tool works by converting all supplementary reads to primary reads, and then change the names ...
0
votes
1answer
67 views

Supplementary aligments in VAF

This question has also been asked on Biostars I have a doubt, are supplementary alignment usually considered when the variant allele frequency is calculated? Thanks a lot. In my case I have some ...
2
votes
1answer
28 views

Understanding ViennaRNA RNAdistance scoring table

I'm trying to compare the output of 2 different algorithms of RNA structure prediction (my implementation of Nussinov vs RNA-mfold algorithm) using the RNAdistance algorithm that is part of ViennaRNA ...
1
vote
1answer
52 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
0
votes
1answer
121 views

TopHat2 versus HISAT2 inner workings

In my intro to bioinformatics course, we mentioned that TopHat2 and HISAT2 will both try to align as many reads as possible to the reference genome (TopHat2 has been superseded by HISAT2). For the ...
2
votes
1answer
65 views

Translating a genome sequence into possible frames

I have a sequence below from MYC gene about which I need to translate the sequence in all possible frames AND identify (for each frame) which codons are actually used in MYC ...
3
votes
2answers
3k views

Error while calling bcftools mpileup - Failed to open -: unknown file type

I have sequenced a bacterial genome with a GridIon from ONT. Basically what I want to check is whether or not trimming 50 bps at the beginning of the reads will improve alignment against the reference ...
1
vote
1answer
42 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
0
votes
0answers
114 views

STAR aligner multiple fastq files

I’m using STAR to align fastq files from SMART-seq2. I have raw data folder containing sub-folders with samples names the sub-folders each contain fastq file. How can I make a bash command in order ...
1
vote
1answer
75 views

merge the matrix from computematrix of deeptools

I have several matrix from computematrix of deeptools. I need to merge two of them using "computeMatrixOperations cbind -m input1.mat.gz input2.mat.gz -o output.mat.gz" but I am running to error "/...
0
votes
1answer
137 views

How to calculate mutation rate and mutation sites in a genome using FASTA file?

I have 6 viral genome sequences of the same virus and 1 reference sequence in FASTA format. How I can identify mutations and mutation sites in those genomes using FASTA sequences but how I can do ...
3
votes
2answers
262 views

Frequency of specific viral sequence in .BAM or .fastq

I was wondering if anyone had any experience 'counting' the frequency of a particular viral sequence in an individual's fastq sequence. So basically, counting the number of occurrences of a particular ...
1
vote
1answer
106 views

Assessing PyMol sequence alignment object

I use cealign in PyMol for structure alignment. Instead of visualization, I want to return the alignment object to my python script for further analysis. Is there a function to return the object ...
1
vote
1answer
28 views

Measure the purifying selection for certain taxa along a phylogeny

I am posting this message because I need clarity about the analysis I want to perform. In my analysis, I have a homologous gene in 13 species, and I would like to evaluate the selection pressure of ...
0
votes
2answers
47 views

What programs account for structural alignment of different parts of distant homologs which have significant structural differences?

If there is a need to perform structural alignment of different parts of distant homologs, which program one should use? Since distant homologs often have significant structural changes, meaning the ...
13
votes
1answer
4k views

Better aligner than bowtie2?

Bowtie2 is probably the most widely used aligner because of it's speed. Burrow-wheeler (BW) algorithms (including bwa) tend to ...
1
vote
0answers
31 views

BAM file filteing to remain best isoform

I ran HiSat2, MarkDuplicate, removed reads with the lower quality score than 40 and finally only kept properly paired reads. After the BAM filtering steps, I used the Scallop results with TransDecoder....
0
votes
1answer
41 views

Display a score or graph to visualize the degree of conservation of each residue from alignment data

I would like to display a score or graph to visualize the degree of conservation of each residue from the amino acid alignment data. If possible, I'd like to extract the parts of the game that scored ...
0
votes
1answer
27 views

Installation of PRANK MSA in WLS Ubuntu 20.04 LTS

I want to install PRANK on the Windows 10 Linux subsystem (Ubuntu 20.04 LTS), I have followed the installation instructions to no avail. ...
1
vote
1answer
112 views

why in RNA seq don't we only use reference transcriptome?

I would like to ask why in RNA seq analysis (alignment step) we use sometimes reference genome instead of reference transcriptome? thank you!
1
vote
0answers
24 views

What are the symbols of $*$ and '$\_$' in an unknown alignment format for HLA data from the IMGT dataset?

Has anyone worked with the IMGT HLA database/dataset before? IMGT-HLA git repo they have some convenient text files (eg. link to gene A .txt file) with the genomic data for the different alleles of ...
3
votes
1answer
282 views

Difference between genome assembly and genome sequence alignment to a reference to find structural variants

I'm trying to determine what the difference and benefits of genome assembly and genome sequence alignments are when trying to identify structural variants or transposons in populations. I've been ...
4
votes
1answer
458 views

How to map short sequences to long reads, recovering all multiply-mapped high-quality matches

The dilemma: I have around one million short sequences (21 bp to several 100s of basepairs) for which I need to identify all occurrences of in 20-30x coverage noisy long reads (both pacbio and ONT). ...
1
vote
0answers
208 views

bedtools coverage - Report the depth at each position in each A feature

I am using bedtools coverage to compute the sequencing depth at every positions of a chromosome but it didn't work as I expected. Instead it reported 0 coverage at every positions. This is how I did ...