Questions tagged [bedtools]

The tag has no usage guidance, but it has a tag wiki.

Filter by
Sorted by
Tagged with
1
vote
1answer
43 views

bedtool intersect multiple bed files

I have 7 biological replicate of a normal sample after peak-calling I converted it into bed files and now I want to find what are the common region between those . So i tried with bedtool intersect ...
1
vote
1answer
17 views

Bedtools get fasta and ORF from a blastX run

Hello I made a blastX research (A query genome in nucleotide format translated into protein in 6 reading frames against a protein dabatase) And here is a head of ...
1
vote
0answers
43 views

bedtools coverage - Report the depth at each position in each A feature

I am trying to use bedtools coverage to compute the sequencing depth at every positions of a chromosome but it didn't work as I expected. It reported 0 coverage at every positions. This is how I did ...
1
vote
2answers
61 views

bedtools intersect on very large .bam file - -sorted confusion

I need to do a bedtools intersect operation on a very large .bam file. When I use the standard bedtools intersect operation, the process consumes all the memory on my system. From the bedtools ...
2
votes
2answers
59 views

How to best detect the “peaks” in RNA-seq data that are not assigned to any gene?

I encountered that many reads from single-cell RNA seq data were lost in the analysis because not assigned to any gene (genome: galgal6). I am trying to find an approach than could give me all the "...
0
votes
0answers
44 views

multiBamCov for counting reads overlapping a bin interval

I am using multiBamCov from bedtools to count reads in my bed file. I want to count the reads in the specified bins in my bed file such that if the read in the bam file overlap the interval more than ...
5
votes
3answers
224 views

How to do `bedtools intersection` using pandas alone?

I have two pandas Dataframes, using python3.x: ...
1
vote
1answer
43 views

bedtools feature out of bounds

I'm trying to count the GC in regions leading up to polyA clusters. I found the bedtools command nuc, one of the outputs of which is the GC content. I took the mouse polyA cluster database from here,...
4
votes
3answers
166 views

How can I calculate coverage at single bases using a bam file?

I'm looking for a way to input a vcf or bed file (with specific base positions) and a bam file, and get the coverage at each base position (ie single base bins) using the bam file. I also want the ...
-8
votes
1answer
127 views

Extracting the number SNP in each range

I have called copy number and I have 2 files (I have shared the link of my files ); One contains some ranges ...
0
votes
1answer
152 views

bedtools unable to open file despite being tab-delimited

I got the following error when attempting to intersect two files. The file below is supposed to be the -a file. ...
2
votes
2answers
53 views

bedtools: get name column of alignment file A

I'm using the coverage function of bedtools to check whether a certain set of regions (file B) has any overlap with known ...
2
votes
2answers
163 views

Unable to install bedtools on windows 10 ubuntu

I am trying to install bedtools on windows 10, but I get an error I don't understand. How can I fix it? ...
1
vote
0answers
127 views

bedtools single-nucleotide coverage in BED-specified regions for multiple BAMs

I have a BED6 (BED + name, score, strand info) file that defines some regions of interest. I also have a set of BAMs corresponding to different samples. I would like to obtain output similar to <...
3
votes
1answer
66 views

How to paste RSIDs in CADD output

I want to paste RSIDs in CADD output as CADD does not give RSID column in its output. For this purpose I am using bedtools intersect to compare two files and have RSID column in my CADD file. This is ...
2
votes
5answers
988 views

How to create a .bed file from .fasta? [duplicate]

I have some problems with creating a .bed file for hg19 which I will be able to load on IGV. The fasta file contains rows of this form: ...
0
votes
0answers
38 views

From bedtools “genomecov” back to .bed

I have the results of: bedtools genomecov -d... Output: 0 0 10 10 10 20 20 And i want to convert it back to bed file. e....
2
votes
1answer
41 views

Comparing two files with overlapping regions and get their associated information

I have two file that have overlapping regions. One file has chromosomes, position, CNV data and samples.Other file has chromosomes, positions and ensemble ids of genes. Here is some lines of two ...
6
votes
1answer
99 views

Generating random BED intervals given constraints

Problem is to generate a random BED interval given the following constraints: minimum start maximum end fixed length maximum ...
4
votes
1answer
37 views

How to use variables while calling pybedtools

I am trying to use bedtools and fetch sequences from a whole genome fasta file inside the script I get region coordinates as variables. For example: ...
3
votes
1answer
43 views

How to apply function on bedfile based on a reference bedfile

I have two bed-like files: File1 ...
2
votes
1answer
427 views

How to split bedfile into non-overlapping regions and compute aggregation function on duplicate segments

I have a bed-like file in which I have several overlapping regions with associated features. I want to split the overlapping regions into disjoint regions in order to process the file (e.g. with ...
0
votes
2answers
143 views

Filtering bam file with bedtools intersect using strand specificity

I have a small sample of records from a bam file. I obtained them by intersecting with a bed file not enforcing strand-specificity. So I get them all back upon performing the same intersection again: ...
6
votes
4answers
413 views

Merging regions according to their identifier

I have a huge file (20 GB) which has a range of genomic locations, and for each location there is an identifier(4th column), ...
2
votes
1answer
304 views

bed file merge book-end features only if same name in column 4

I have a bed file where some entries have the same name in column 4 but are book-ended in coordinates, e.g. see below: ...
0
votes
2answers
214 views

bed entries collapse based on score column

I have a bed file where some entries have the exact same chr:start-end but change in the name and score column. I would like to apply bedtools or a similar tool to obtain a filtered file where for ...
2
votes
2answers
243 views

Parse out exon coordinates from bed file for each gene

This is my bed file for all the exon coordinates I want to take out all the exons of a given gene. Let say I have gene in chr 1 which starts from chr1 11868 12227 ...
1
vote
2answers
324 views

Approximate matches with bedtools intersect

I am using bedtools to test whether a set of variant calls produced by a new method is missing any variants from a set of known validated variants. ...
4
votes
2answers
141 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
2
votes
1answer
228 views

Dealing with indels when converting a position to chromStart and chromEnd for a bed file

Starting with a chromosome # and position, I am trying to get chromStart and chromEnd values for a .bed file, but I am not sure how to calculate chromEnd when I have a variant that is an insertion or ...
7
votes
1answer
2k views

How to count reads in bam per bed interval with bedtools

I recently installed Ubuntu 16.04 (because I was still using 12.04). But it seems my bedtools scripts don't work properly anymore. I can't figure out how to use the new bedtools for my old ways. What ...
4
votes
1answer
158 views

How to filter intervals (reads or genomic coordinates) that have the exact same 5' or 3' ends?

Say I have reads that overlap some genes that produce small RNAs, but I want only those reads that start at exactly the TSS of the loci. In other words, reads whose 5' end match the 5' end of a ...
6
votes
5answers
1k views

Merging bed records based on name

I generated a file starting with the following bed lines: ...
3
votes
1answer
315 views

How to extract exome on-target reads in batch?

I was given a list of target regions in BED and many exome alignments in BAM. I was asked to extract on-target alignments from these BAMs to save disk space. I know I can use bedtools to extract sub-...