Questions tagged [bioawk]

For questions about bioawk, an extension of the unix core utility command awk.

Filter by
Sorted by
Tagged with
3
votes
1answer
42 views

Find pattern that is present twice and allow <=2 mismatches on each

I have a fastq file of 400,000 reads (so speed is important). In the sequences there are barcodes integrated that should be present twice. Given a barcode, I want to find the sequences that have the ...
1
vote
1answer
37 views

how to repeat records in fastq n times efficiently?

How to iterate/repeat a record n times in a fastq file using bioawk? I wrote a python code using biopython, but it is very very slow. So, I am wondering if I can get some help by using bioawk. Thank ...
6
votes
5answers
1k views

Delete all 4 lines of a fastq read from a fastq file using read ID

I have the following error when running bowtie2: Error: Read HWI-D00466:116:CC62WANXX:3:1102:7363:63646 1:N:0:GCACACG has more read characters than quality values. I now want to remove all 4 ...
2
votes
2answers
239 views

filter out FASTQ reads which are shorter

I tried to filter out FASTQ reads which are shorter than 259 bp with ...
4
votes
1answer
94 views

bioawk removed part of FASTQ header

I used bioawk -cfastx 'length($seq) > 1 {print "@"$name"\n"$seq"\n+\n"$qual}' in.fq.qz | gzip > out.fq.qz in order to keep a particular read length, but ...
4
votes
2answers
5k views

Calculating read average length in a Fastq file with bioawk/awk

I found here this awk script: ...
3
votes
1answer
94 views

Splitting characters of a column in repeated lines and reducing them to one line

I have a file with sample data like this: ...
4
votes
1answer
76 views

Intersecting two different files with one “master” file based on different columns

I have the following sets of data: file1: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG file2: ...
4
votes
2answers
151 views

Using column 2 of one file to match with two columns of another file, and append

I have file 1 like following: 1 15776220 15776240 GTGACCAGCAGGTGTCTCTG 16855676 16855696 CTGTCCAGCAGAGGGCGGTG And file 2 as following ...
9
votes
3answers
1k views

Selecting sites from VCF which have an alt AD > 10

I have high-depth variant calling created using the HaplotypeCaller with --output_mode EMIT_ALL_SITES I'm interested in finding all sites (regardless of genotype ...
4
votes
1answer
219 views

What kind of “gff” format does bioawk parse?

I was wondering if I could use the gff parsing capability of bioawk to facilitate the parsing of gtf files, and I looked at the following help message: ...