Questions tagged [biopython]

Biopython is a set of freely available tools for biological computation written in Python.

Filter by
Sorted by
Tagged with
5
votes
3answers
2k views

How to translate amino acid sequences to Nucleotide sequences

I want to convert a list of fasta ( protein sequences) in a .text file into corresponding nucleotide sequences. A Google search gives me result of DNA to protein conversion but not vice versa. Also, I ...
3
votes
2answers
49 views

Why does it require 4 vectors to calculate a torsion angle?

The BioPython documentation shows the following: 11.6.3 Measuring torsion angles Use the vector representation of the atomic coordinates, and the calc dihedral function from the Vector module: ...
1
vote
2answers
201 views

How to sort multiple FASTA files based on their content?

I have around 10,000 FASTA files of Influenza A virus. These files contains sequences of each of the 8 segments of the viral genome and I want to separate these files into different locations based on ...
9
votes
2answers
2k views

How do you generate read-length vs read-quality plot for long-read sequencing data (e.g., MinION)?

How do you generate read-length vs read-quality plot (heat map with histograms in the margin) for long-read sequencing data from the Oxford Nanopore Technologies (ONT) MinION? The MinKNOW software ...
2
votes
1answer
100 views

Retrieve ID ligand from PDB file

I have thousands of PDB files and I need to extract the following information from each of them: an ID or the name of the small molecule (ligand) present in the complex. Is there a way to do that ...
10
votes
1answer
2k views

Changing the record id in a FASTA file using BioPython

I have the following FASTA file, original.fasta: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need ...
3
votes
2answers
97 views

How to make 3d model of a protein that not exist in PDB?

I'm working on nsSNPs(Non-synonymous single nucleotide polymorphisms) of protein AKAP13 whose PDB not available. I did one mutation in this protein and I want to show the effect by 3d modeling without ...
2
votes
2answers
561 views

Get a list of PDB ids from a list of sequence protein number?

I am working on a project about phosphorylation, and I am creating a database of some proteins. I have a list of protein accession ids for which I need to get the corresponding PDB file for each one ...
2
votes
1answer
86 views

Infer the new (Ban et. al) ribosomal nomenlature (ex. uL53 ) from the ribosomal protein's sequence

I'm trying to programmatically construct a name for each protein subchain in any ribosome from Uniprot in accordance with Ban et. al's 2014 proposal (excerpt given below) using PDB's and Uniprot's ...
1
vote
1answer
56 views

How to allow "half windows" in biopython?

I am using Biopython to examine protein sequences including the Kyte and Doolittle hydrophobicity. However, for short sequences, this returns an empty value; the value is not allowed if the window ...
0
votes
1answer
34 views

How can I get a list of neighboring Hydrogen atoms of an alpha-carbon?

Suppose, I want to find the neighboring Hydrogen atoms of a specific C-alpha atom. The following was my effort. However, it produces a bunch of empty lists. ...
8
votes
1answer
403 views

Getting protein FASTA sequence based on keyword with python

I would like to gather proteins FASTA sequence from Entrez with python 2.7. I am looking for any proteins that have the keywords: "terminase" and "large" in their name. So far I got this code: ...
4
votes
2answers
709 views

Finding a single open reading frame with ribosomal binding site, using Biopython

I'm given a Fasta file, containing a large DNA(over 115,000 long) sequence, and I am tasked with finding a single large open reading frame contained within the DNA sequence using Biopython. I'm ...
0
votes
1answer
298 views

Remove Redundant Sequences from FASTA file in Python

I'm attempting to remove redundant sequences from a fasta file (from NCBI). When I execute this code, it returns the number of spots, not the number of sequences. (Number of spots: 408,293, Number of ...
0
votes
2answers
45 views

How to obtain desired output?

I am working on a project using the following command within nano: ...