Questions tagged [biostrings]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1 vote
1 answer
65 views

seeing full results on R

running this code on R, using the Biostrings package, vmatchPattern("GAAGACCGAGGCCACGCGGAGTACGAACGAGGGTACAGTCTTC", mySeq) in the console, it writes: <...
Farzad Beikpour's user avatar
1 vote
2 answers
111 views

Making a DNAStringSet object

I wish to download a fasta sequence from NCBI using "rentrez" package and then save it in an object, then I want to have this object as a DNAStringSet object to work on the sequence using &...
Farzad Beikpour's user avatar
3 votes
1 answer
6k views

How to transform a DNAStringSet from the Bioconductor package Biostrings to a data frame?

I am working on Mac OS X. I am using R version 3.5.1. I have important a FASTA file into R using Biostrings::readDNAStringSet. This creates a DNAStringSet object ...
Biomagician's user avatar
  • 2,459
5 votes
0 answers
213 views

R Biostrings pairwiseAlignment to BAM

The R package Biostrings has a function to create a pairwiseAlignment from pattern and subject sequences. So far I can save the result into a text file using writePairwiseAlignments. I would like to ...
Green's user avatar
  • 151
4 votes
1 answer
361 views

Given a Genomic Ranges of SNPs, how to inject these SNPs in genome via BSGenome?

Let's say I have the genome hg19 loaded into R via BSGenome ...
ShanZhengYang's user avatar