Questions tagged [blast]

Basic Local Alignment Search Tool: algorithm that finds regions of similarity between a pair of sequences, can be used to query an unknown sequence against a database of known sequences.

Filter by
Sorted by
Tagged with
1 vote
1 answer
25 views

What does this BLASTN mean: Error pre-fetching sequence data?

I am trying to run BLASTN on a 14GB Pseudomonas database using the command: blastn -db ~/pseudomonas-db/pseudomonas -query ~/desktop/inputfiles/poz176.fasta -out poz176-out -num_threads 8 I get the ...
blackthorne18's user avatar
1 vote
2 answers
94 views

How can I limit blast results to exclude a specific taxonomic ID?

I would like to perform blast+, using the command line, here is the code: -task blastn -db nr -outfmt 7 -query myQuery.fas -out result.txt -remote. I have to ...
Farzad Beikpour's user avatar
1 vote
1 answer
68 views

Blastn through NCBIWWW not giving any results, as opposed to the online BLAST

I am trying to create a simple pipeline that takes a file containing various short sequences, and run them through blast. I have an example sequence; ...
Bas Jansen's user avatar
2 votes
1 answer
40 views

retrieving past BLAST requests in bioPython

is there any way to retrieve a BLAST request made using the Biopython library using the request's query_id? Alternatively is it possible to retrieve a query_id before the blast result is complete, and ...
kama's user avatar
  • 21
0 votes
1 answer
32 views

how to use BLAST+ in an optimal way

I have a 32-bp query that I want to perform BLAST+. my query represents different RNA viruses and I do expect that my hits get more than 500,000. but in practice, when I perform it I get around only ...
Farzad Beikpour's user avatar
2 votes
2 answers
76 views

How to BLAST a protein against a large set of organisms?

I have a list of organisms with their full scientific names and Taxonomy IDs, total ~1500. I want to BLAST my protein against this 1500 genome or proteome. How can I do that? Here a sample protein ...
Supertech's user avatar
  • 596
2 votes
0 answers
157 views

BLAST+ not working on my Command Line

As you know, ncbi has several databases, including nt, nr, etc. What I am going to do is to blast a sequence of approximately 30 base pairs to the nr database and extract all similar sequences. For ...
Farzad Beikpour's user avatar
1 vote
2 answers
221 views

Parameter optimisation of minimap2

I'm leveraging minimap2 to map select genes from short-read microbial fastq metagenomics zip files. ...
M__'s user avatar
  • 12.1k
3 votes
2 answers
79 views

Remote NCBI's Blast Perl API: maximising hits returned via command line

Question and Background I'm using NCBI's Blast Perl API to interrogate Genbank for example blastp. I don't get the throughput using their point and click web stuff. ...
M__'s user avatar
  • 12.1k
0 votes
0 answers
138 views

IgBLAST Error: Germline annotation database could not be found in [internal_data] directory

I'm in the following situation and I came here to see if I could get some help. I'd like to use IgBLAST for an analysis on some Alpaca antibody data, so I received some FASTA sequences from a ...
Phantom Photon's user avatar
2 votes
2 answers
143 views

How to get full alignment output from BLASTP?

I am running a blastp search: time ~/bin/ncbi-blast-2.14.0+-src/c++/ReleaseMT/bin/blastp -db nr -query X.fasta -out nr.X -num_descriptions 4000 -remote but I have ...
con's user avatar
  • 125
2 votes
1 answer
34 views

NCBI Blast databases - cannot find some databases

I'm working with a system that does local BLAST searches using some preconfigured BLAST databases. From what I see, these were updated within the last year, but I cannot find any current databases ...
KirkD-CO's user avatar
  • 175
3 votes
1 answer
64 views

compare fasta sequences in pairs and collect metrics

I have 96 fasta files (A1, A2, A3...) from one plasmid assembly pipeline, and I have another 96 fasta files (B1, B2, B3 ...) from another plasmid assembly pipeline. I would like to compare pair ...
cautree's user avatar
  • 139
3 votes
1 answer
88 views

Extract specific nucleotide base position for query and subject from text file

I have an input file looks like this: ...
user14714429's user avatar
1 vote
1 answer
53 views

Given a FASTA file with a set of genes, how do I determine that set's conservation among a genetic order?

Given a set of genes in a FASTA-formatted file, for example: exFasta.fa, what is the best way to determine how well conserved the genes in that file are among an ...
Jacob's user avatar
  • 11
1 vote
1 answer
237 views

Gene symbol list for all protein coding genes in mice

How can I get a csv or a list of the gene symbol names for all the protein coding genes in mice? I have RNA sequencing data and I'm not interested in the non-coding stuff. I'm worried it could mess ...
Angus Campbell's user avatar
1 vote
0 answers
23 views

Print indel/mismatch in a blastp stream

I am in need of a simple tool that accepts an XML file generated by a BlastP as input and gives me back a file containing information about mismatches/indels/etc. Fortunately such a tool already ...
Eduardo M.'s user avatar
-2 votes
1 answer
111 views

How can I identify the virulence factors in my FASTQ files generated from nanopore sequencing bacteria DNA?

I have performed genomic sequencing using nanopore technology and upon analysing using BLAST in the command line I have identified the presence of E.coli. I was wondering if I can add some code to ...
wilkohollie's user avatar
2 votes
1 answer
101 views

What do you use the CLANS program for?

I am reading this paper called Birth and death in the Terminal Complement pathway, doi : https://doi.org/10.1101/2022.04.21.489004 where they have performed CLANS analysis. I understand that CLANS ...
venkatesh war's user avatar
1 vote
2 answers
149 views

Is there an equivalent of Entrez queries for local BLAST?

I have been having some trouble with running command line BLASTn remotely. Therefore, upon recommendations, and considering I have >100 searches planned, I am considering just downloading the nt ...
Laura's user avatar
  • 909
3 votes
2 answers
404 views

Remote blastn - what is breaking my (bash) loop?

I am trying to search the NCBI non-redundant database for sequences similar to a few other (~40) sequences that I already have. So I've tried running blastn remotely, and looping through multiple ...
Laura's user avatar
  • 909
0 votes
3 answers
173 views

How to identify [hyper]thermophilic proteins by BLAST search?

I need to find homologs of certain proteins by BLAST search or similar. But I want filter (select) homologs from organisms that are classified as thermophilic or hyperthermophilic. I am wondering if ...
Supertech's user avatar
  • 596
3 votes
1 answer
87 views

tblastn not providing full alignment even on exact-matching sequences

I am using tblastn to search a polypeptide seq against transcripts. One of those transcripts contains the residues for that exact polypeptide once translated, yet BLAST only gets 88% of it rather ...
Jorvis's user avatar
  • 133
4 votes
1 answer
360 views

Assign multiple taxids to a sequence when constructing a local BLAST database

I recently had a script fail due to poor handling of BLAST output. The BLAST -outfmt staxids field usually returns a single taxid, but occasionally it returns two ...
Daniel Standage's user avatar
3 votes
0 answers
118 views

PSSM Matrix in PSI-BLAST

After running PSI-BLAST one obtains a profile matrix with this header: A R N D C Q E G H I L K M F P S T W Y V How does PSI-...
Caterina's user avatar
  • 307
1 vote
2 answers
473 views

How to retrieve fasta sequence after local blast?

I have created a Blast database using a reference genome. Then, I have performed a local blast search in command line using a gene of interest. I have obtained some hits with the usual Blasting ...
Anik Dutta's user avatar
0 votes
0 answers
38 views

Identifying Variant Conservation Across Species

I've got gene sequences of mouse genes. Each sequence contains variants from the reference genome. I need to find out whether these SNPs/variations are in functionally significant regions (i.e. exons)....
syrupflow's user avatar
2 votes
1 answer
45 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
Set's user avatar
  • 241
1 vote
1 answer
38 views

How do you search for new enzymes that are more stable for handling, immobilization?

Noob here. I get that I should deduce what characteristics the ideal new enzyme should meet, and then use tools such as PDB and blast to compare to the old enzymes, and use other tools such as pymol, ...
715 715's user avatar
  • 19
2 votes
1 answer
36 views

mpiblast alternatives?

I am looking for a sequence alignment software capable of pairwise alignment of a large number of protein sequences (10^7). I tried to go for mpiblast: https://wiki.canterbury.ac.nz/display/UCHPC/...
Johnny Tam's user avatar
1 vote
0 answers
261 views

How to use SRA Toolkit to blast SRA accessions?

I'm trying to look for a gene in a group of SRA files. Web BLAST can't cope with them, so I assume they're too large. I've tried tblastn_vdb from the SRA toolkit, as follows. It had previously worked ...
Laura's user avatar
  • 909
2 votes
1 answer
102 views

Pseudocode for gapped BLAST seed extension

I am trying to understand in detail how does the gapped BLAST seed extension DP algorithm works. Despite searching for days now, I could not find anywhere a pseudocode that would allow implementing ...
Daniel's user avatar
  • 23
2 votes
2 answers
1k views

Timeout when downloading the ncbi nr blast database

I am experiencing timeout problems when downloading the NCBI nr preformatted blast database using the update_blastdb script (version 504861). I run the script with the following paramters ...
C. Zeil's user avatar
  • 121
3 votes
1 answer
94 views

How low does an E-Value need to be for a gene to code for the same protein as query?

I'm looking at a bacterial genome and trying to find specific PEGs (Protein Encoding Genes) by BLAST searching. I'm taking the genes found with the lowest E-value in order to psiBLAST them to check it ...
Ana978's user avatar
  • 31
2 votes
1 answer
170 views

What kind of BLAST do I need to do to accomplish this task?

(I am a complete newbie to bioinformatics, so please bear with me!). I recently used BLAST to compare a 500 bp nucleotide sequence in S. cerevisiae to a bunch of other 500 bp nucleotide sequences in ...
Aqsa Alam's user avatar
1 vote
1 answer
297 views

Find species from FASTA files

In a school project we got the task of finding the species from two FASTA files. We got some hints of what to look for, like it is a unicellular eukaryote and that we can use blast. We don't know if ...
ingrle's user avatar
  • 21
1 vote
1 answer
114 views

How to identify genes from a genome assembly of C. Elegans?

I have two full genome assemblies for C. Elegans samples collected from two different geographical areas that I found on WormBase. These are in fasta format. I want to go gene-by-gene and compare the ...
Jabbath's user avatar
  • 113
1 vote
0 answers
346 views

How to read E-value annotation on NCBI BLAST?

I am seeking clarification on how to read the E value annotation on NCBI's BLAST results. What I understand so far: E -values are the expected value of the number ...
user12256545's user avatar
0 votes
0 answers
31 views

What is the meaning of letter 'c' in tblastn results before genomic sequence position?

An example of a result. So far I have been unable to find the answer on my own. ">CP000000.0:c2005000-2006000 Escherichia coli strain XYZ chromosome ATG..."
bionewb0000's user avatar
1 vote
1 answer
81 views

Does BLASTClust guarantee that proteins in different clusters are dissimilar?

I need to find dissimilar proteins. Looking through the PDB I found the weekly BLASTClust results of proteins that are 30% similar. However, I do not know if protein A in cluster 1 is guaranteed to be ...
lazer-guided-lazerbeam's user avatar
0 votes
0 answers
39 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
AlphaQueUp's user avatar
1 vote
1 answer
217 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
Biochem's user avatar
  • 113
1 vote
2 answers
499 views

BLASTn query coverage discrepancy

Using the BLASTn webtool with, Query Seq: CAATTGCGAAGCCACATTATT Subject Seq: CP031332.1 BLASTn returns a single hit to CP031332.1 with query coverage at 100%. However if one looks at the alignment, ...
Set's user avatar
  • 241
2 votes
1 answer
423 views

NCBI blast for exact match of a short sequence

I'm trying to Blast for exact matches to the sequence: 'ATTGNNNNGCAAACCA' in the human transcriptome using NCBI Blast on its 'refseq_rna' database. However, when I do a basic query I get "No ...
Mike Flynn's user avatar
0 votes
1 answer
281 views

Does NCBI's blast API block my IP?

I am trying to run a blatn command from both my laptop and within a google colab notebook. I am not sure why, but this command runs properly once and then, on the ...
0x90's user avatar
  • 1,427
3 votes
2 answers
79 views

How to find possible viral subsequences in a Eukaryote genome?

I have an assembly of an algae and want to find if it has anything analogous to endogenous retroviruses' subsequences in its DNA. My guess is I should manually blastn all subsequences until I find (or ...
gl00ten's user avatar
  • 249
2 votes
2 answers
65 views

Software for taxonomic assignment?

I have a couple of hundred bacterial sequences of 2-30 genes of interest each, recovered from metagenomics. None of them encode rRNA. Normally I'd just BLAST the one gene I already know to be reliable ...
Laura's user avatar
  • 909
2 votes
2 answers
3k views

how to have a blast xml file in a readable and understandable way

I got a blast xml file after a DNA sequence search. The XML file is not very readable. What is the way to make it more understandable? This blast contains about twenty matches. Here is the xml file
serpipanton's user avatar
1 vote
1 answer
372 views

Do you know a program/script to count how many sequences have mismatches on each position of my primers?

I'm working with primer analysis and design, and so far I've performing it in Excel but: a) I don't like Excel, b) I do it manually, c) I don't like Excel, d) it gets tedious when working with ...
Gaston's user avatar
  • 11
1 vote
1 answer
225 views

Blast results filters

I performed a blastn search of NGS data against ssRNA database download from Internet, with a expected value 10-4. The size of NGS data reads is of 125 bp. I have analyzed the blast results of the ...
Adrián P.L.'s user avatar