Questions tagged [blast]

Basic Local Alignment Search Tool: algorithm that finds regions of similarity between a pair of sequences, can be used to query an unknown sequence against a database of known sequences.

Filter by
Sorted by
Tagged with
0 votes
3 answers
65 views

How to identify [hyper]thermophilic proteins by BLAST search?

I need to find homologs of certain proteins by BLAST search or similar. But I want filter (select) homologs from organisms that are classified as thermophilic or hyperthermophilic. I am wondering if ...
user avatar
  • 326
2 votes
1 answer
20 views

tblastn not providing full alignment even on exact-matching sequences

I am using tblastn to search a polypeptide seq against transcripts. One of those transcripts contains the residues for that exact polypeptide once translated, yet BLAST only gets 88% of it rather ...
user avatar
  • 123
4 votes
1 answer
101 views

Assign multiple taxids to a sequence when constructing a local BLAST database

I recently had a script fail due to poor handling of BLAST output. The BLAST -outfmt staxids field usually returns a single taxid, but occasionally it returns two ...
user avatar
3 votes
0 answers
24 views

PSSM Matrix in PSI-BLAST

After running PSI-BLAST one obtains a profile matrix with this header: A R N D C Q E G H I L K M F P S T W Y V How does PSI-...
user avatar
  • 131
1 vote
2 answers
74 views

How to retrieve fasta sequence after local blast?

I have created a Blast database using a reference genome. Then, I have performed a local blast search in command line using a gene of interest. I have obtained some hits with the usual Blasting ...
user avatar
0 votes
0 answers
19 views

Identifying Variant Conservation Across Species

I've got gene sequences of mouse genes. Each sequence contains variants from the reference genome. I need to find out whether these SNPs/variations are in functionally significant regions (i.e. exons)....
user avatar
2 votes
1 answer
33 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
user avatar
  • 249
0 votes
1 answer
21 views

How do you search for new enzymes that are more stable for handling, immobilization?

Noob here. I get that I should deduce what characteristics the ideal new enzyme should meet, and then use tools such as PDB and blast to compare to the old enzymes, and use other tools such as pymol, ...
user avatar
2 votes
1 answer
29 views

mpiblast alternatives?

I am looking for a sequence alignment software capable of pairwise alignment of a large number of protein sequences (10^7). I tried to go for mpiblast: https://wiki.canterbury.ac.nz/display/UCHPC/...
user avatar
1 vote
0 answers
136 views

How to use SRA Toolkit to blast SRA accessions?

I'm trying to look for a gene in a group of SRA files. Web BLAST can't cope with them, so I assume they're too large. I've tried tblastn_vdb from the SRA toolkit, as follows. It had previously worked ...
user avatar
  • 595
2 votes
1 answer
71 views

Pseudocode for gapped BLAST seed extension

I am trying to understand in detail how does the gapped BLAST seed extension DP algorithm works. Despite searching for days now, I could not find anywhere a pseudocode that would allow implementing ...
user avatar
  • 23
0 votes
0 answers
48 views

Difference in BLAST and eggNOG

Note: this question has also been asked on Biostars This is question regarding the tools rather than the concepts. I am a freshman at college and I am a working on an evolutionary biology of ...
user avatar
2 votes
2 answers
467 views

Timeout when downloading the ncbi nr blast database

I am experiencing timeout problems when downloading the NCBI nr preformatted blast database using the update_blastdb script (version 504861). I run the script with the following paramters ...
user avatar
  • 81
3 votes
1 answer
83 views

How low does an E-Value need to be for a gene to code for the same protein as query?

I'm looking at a bacterial genome and trying to find specific PEGs (Protein Encoding Genes) by BLAST searching. I'm taking the genes found with the lowest E-value in order to psiBLAST them to check it ...
user avatar
  • 31
2 votes
1 answer
102 views

What kind of BLAST do I need to do to accomplish this task?

(I am a complete newbie to bioinformatics, so please bear with me!). I recently used BLAST to compare a 500 bp nucleotide sequence in S. cerevisiae to a bunch of other 500 bp nucleotide sequences in ...
user avatar
1 vote
1 answer
101 views

Find species from FASTA files

In a school project we got the task of finding the species from two FASTA files. We got some hints of what to look for, like it is a unicellular eukaryote and that we can use blast. We don't know if ...
user avatar
  • 21
1 vote
1 answer
62 views

How to identify genes from a genome assembly of C. Elegans?

I have two full genome assemblies for C. Elegans samples collected from two different geographical areas that I found on WormBase. These are in fasta format. I want to go gene-by-gene and compare the ...
user avatar
  • 113
0 votes
0 answers
69 views

How to read E-value annotation on NCBI BLAST?

i am a bit confused how to read the current E value annotation on NCBI BLAST results. I looked into the matter but could not find an factual answer . What i understood so far: E -values are the ...
user avatar
0 votes
0 answers
30 views

What is the meaning of letter 'c' in tblastn results before genomic sequence position?

An example of a result. So far I have been unable to find the answer on my own. ">CP000000.0:c2005000-2006000 Escherichia coli strain XYZ chromosome ATG..."
user avatar
1 vote
1 answer
63 views

Does BLASTClust guarantee that proteins in different clusters are dissimilar?

I need to find dissimilar proteins. Looking through the PDB I found the weekly BLASTClust results of proteins that are 30% similar. However, I do not know if protein A in cluster 1 is guaranteed to be ...
user avatar
0 votes
0 answers
37 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
user avatar
1 vote
1 answer
77 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
user avatar
  • 13
1 vote
2 answers
118 views

BLASTn query coverage discrepancy

Using the BLASTn webtool with, Query Seq: CAATTGCGAAGCCACATTATT Subject Seq: CP031332.1 BLASTn returns a single hit to CP031332.1 with query coverage at 100%. However if one looks at the alignment, ...
user avatar
  • 249
2 votes
1 answer
175 views

NCBI blast for exact match of a short sequence

I'm trying to Blast for exact matches to the sequence: 'ATTGNNNNGCAAACCA' in the human transcriptome using NCBI Blast on its 'refseq_rna' database. However, when I do a basic query I get "No ...
user avatar
0 votes
1 answer
135 views

Does NCBI's blast API block my IP?

I am trying to run a blatn command from both my laptop and within a google colab notebook. I am not sure why, but this command runs properly once and then, on the ...
user avatar
  • 1,347
0 votes
0 answers
30 views

Blast templates not found in PSI-TM Coffee

I'm trying to run psicoffe mode on Ubuntu 18.04, but it returns the error: 17633 -- WARNING: Impossible to find BLAST Templates Check that your blast server is properly installed [See documentation][...
user avatar
  • 1
3 votes
2 answers
72 views

How to find possible viral subsequences in a Eukaryote genome?

I have an assembly of an algae and want to find if it has anything analogous to endogenous retroviruses' subsequences in its DNA. My guess is I should manually blastn all subsequences until I find (or ...
user avatar
2 votes
2 answers
56 views

Software for taxonomic assignment?

I have a couple of hundred bacterial sequences of 2-30 genes of interest each, recovered from metagenomics. None of them encode rRNA. Normally I'd just BLAST the one gene I already know to be reliable ...
user avatar
  • 595
2 votes
2 answers
1k views

how to have a blast xml file in a readable and understandable way

I got a blast xml file after a DNA sequence search. The XML file is not very readable. What is the way to make it more understandable? This blast contains about twenty matches. Here is the xml file
user avatar
1 vote
1 answer
162 views

Do you know a program/script to count how many sequences have mismatches on each position of my primers?

I'm working with primer analysis and design, and so far I've performing it in Excel but: a) I don't like Excel, b) I do it manually, c) I don't like Excel, d) it gets tedious when working with ...
user avatar
  • 11
0 votes
0 answers
39 views

BLAST, last step: Needleman-Wunsch + S-score

In my bioinformatics course we studied the BLAST agorithm. After finding the HSP's and joining the HSPs together that are close enough and in a correct diagonal trend, we perform a next step: namely a ...
user avatar
1 vote
1 answer
152 views

Blast results filters

I performed a blastn search of NGS data against ssRNA database download from Internet, with a expected value 10-4. The size of NGS data reads is of 125 bp. I have analyzed the blast results of the ...
user avatar
0 votes
1 answer
52 views

Standalone Blast+; Automating searches, Blastn formatting, interpretation

I am struggling with using NCBI's standalone blast, particularly the blastn feature. I have a large number of nucleotide sequences that I want to use blastn to ID. The goal is to retrieve information ...
user avatar
  • 1
1 vote
0 answers
64 views

Analyzing a blast result of NGS data

I am analyzing BLAST results from total RNA NGS, pair ends. This BLAST results was performed against the ssRNA virus database download from NCBI. I filtered those read data whose paired ends ...
user avatar
0 votes
1 answer
33 views

Can you give me a detailed explanation about PrimeBlast?

I am trying to write a research paper on PRIMER-BLAST. I have read something about it on https://www.ncbi.nlm.nih.gov/pubmed/22708584/ but still, it is not enough. So can you please tell me more ...
user avatar
0 votes
1 answer
30 views

how could i find uniprot ac in blast?

I have made a search in p-blast. I would like to search for the protein results in uniprot. how can I do it directly? I can go to GENBANK but i would like to go to UNIPROT. Thank you!!!
user avatar
  • 101
1 vote
3 answers
178 views

Primer-Blast Custom Database [error]

I'm using Primer-Blast to compare a PCR template against a custom database of reference sequences, using Primer-Blast's Custom database functionality. However whenever I try to upload a FASTA file as ...
user avatar
  • 249
0 votes
2 answers
49 views

how can i search in p-blast against UNIPROT(not only swissprot)

i need to search for one protein against UNIPROT in BLAST for a selected organism. How can I do it? (SWSISSPROT+TREMBL) THANKS!!
user avatar
  • 101
2 votes
0 answers
30 views

phmm blast hmmer

i have created a phmm in hmmer from a multiple alignment focused on E. coli produced in tcoffee from sequences taken from blast similar to my query sequence. I would like to ask how i can compare the ...
user avatar
  • 101
6 votes
2 answers
898 views

BERT Language Model and Gene Sequences - How Do I Relate Clusters of Sequences?

I hope you'll indulge a question from a computer scientist with limited bioinformatics knowledge. I've been working with the Google tool for language modeling called BERT. It's generally regarded ...
user avatar
  • 161
2 votes
0 answers
402 views

Cannot blast against specific NCBI databases

I am having issues with some prokaryote reference genome databases (exact names : ref_prok_rep_genomes.*), that I downloaded from the NCBI website : https://ftp.ncbi.nlm.nih.gov/blast/db/. Files in ...
user avatar
2 votes
1 answer
94 views

Possibility to save output blastn table in memory using biopython

Is there a possibility, using biopython to save output table of blastn in memory, not in file on hard drive, for process it using pandas for example and then delete it from memory? I mean, is there a ...
user avatar
  • 53
1 vote
1 answer
302 views

How to do BLASTP for short sequences (<20 aa) effectively?

I am trying to find sequence homology between viral sequences and my protein of interest. I have the sequences of their epitopes which varies from 5 to 500 amino acids long. For shorter sequences, it ...
user avatar
  • 35
2 votes
1 answer
1k views

Cannot blast database created with blastdb_aliastool: BLAST Database error: No alias or index file found

I want to merge/concatenate BLAST databases as suggested here. This is my example script that explains what I'm trying to achieve better than words can: ...
user avatar
  • 191
2 votes
1 answer
66 views

Translating a genome sequence into possible frames

I have a sequence below from MYC gene about which I need to translate the sequence in all possible frames AND identify (for each frame) which codons are actually used in MYC ...
user avatar
0 votes
1 answer
63 views

how to generate structure file from blast results of an input sequence

I have tried to incorporate blast in my application using biopython.i could extract the blast results but now i want to extract the structure file corresponding matches. My code is : ...
user avatar
4 votes
3 answers
240 views

What are the different kinds of bioluminescent genes?

I know of the common green glow gene but I forgot the name and I also know that some algae glow blue. There are so many types of bioluminesent organisms, so I am wondering what species have which ...
user avatar
2 votes
2 answers
68 views

Is there a "definitive" database for Mobile Genetic Elements?

This isn't quite my speciality, but I've been tasked with finding any evidence of Mobile Genetic Elements (like transposable elements, retrotransposons, bacteriophages, etc.) within some WGS samples. ...
user avatar
  • 1,363
1 vote
0 answers
19 views

How can I find genes of fundamental metabolic processes for an organism?

I want to find genes of fundamental metabolic processes in the Phytophthora cinnamomi genome. I'm using the genome sequence deposited in the NCBI and I'm searching ORF by ORF, using the ORF finder (...
user avatar
2 votes
3 answers
109 views

How to find a homolog that has a PDB structure available

I tried to find a homolog that has a PDB structure available so I can use this PDB file for comparative modeling. I ran a BLAST search but none of the search results seemed to have a known structure. ...
user avatar