Questions tagged [blast]

Basic Local Alignment Search Tool: algorithm that finds regions of similarity between a pair of sequences, can be used to query an unknown sequence against a database of known sequences.

Filter by
Sorted by
Tagged with
1
vote
1answer
29 views

Timeout when downloading the ncbi nr blast database

I am experiencing timeout problems when downloading the NCBI nr preformatted blast database using the update_blastdb script (version 504861). I run the script with the following paramters ...
2
votes
1answer
68 views

How low does an E-Value need to be for a gene to code for the same protein as query?

I'm looking at a bacterial genome and trying to find specific PEGs (Protein Encoding Genes) by BLAST searching. I'm taking the genes found with the lowest E-value in order to psiBLAST them to check it ...
2
votes
1answer
70 views

What kind of BLAST do I need to do to accomplish this task?

(I am a complete newbie to bioinformatics, so please bear with me!). I recently used BLAST to compare a 500 bp nucleotide sequence in S. cerevisiae to a bunch of other 500 bp nucleotide sequences in ...
-1
votes
1answer
48 views

Find species from FASTA files

In a school project we got the task of finding the species from two FASTA files. We got some hints of what to look for, like it is a unicellular eukaryote and that we can use blast. We don't know if ...
1
vote
1answer
42 views

How to identify genes from a genome assembly of C. Elegans?

I have two full genome assemblies for C. Elegans samples collected from two different geographical areas that I found on WormBase. These are in fasta format. I want to go gene-by-gene and compare the ...
0
votes
0answers
21 views

How to read E-value annotation on NCBI BLAST?

i am a bit confused how to read the current E value annotation on NCBI BLAST results. I looked into the matter but could not find an factual answer . What i understood so far: E -values are the ...
0
votes
0answers
29 views

What is the meaning of letter 'c' in tblastn results before genomic sequence position?

An example of a result. So far I have been unable to find the answer on my own. ">CP000000.0:c2005000-2006000 Escherichia coli strain XYZ chromosome ATG..."
1
vote
1answer
27 views

Does BLASTClust guarantee that proteins in different clusters are dissimilar?

I need to find dissimilar proteins. Looking through the PDB I found the weekly BLASTClust results of proteins that are 30% similar. However, I do not know if protein A in cluster 1 is guaranteed to be ...
0
votes
0answers
36 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
2
votes
2answers
154 views

Genome assembly of SRR12196449 with SPAdes

I am trying to assemble the run SRR12196449 with SPAdes. The description of their project is: This project expected to standardize a method for amplification and ...
1
vote
1answer
41 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
1
vote
2answers
46 views

BLASTn query coverage discrepancy

Using the BLASTn webtool with, Query Seq: CAATTGCGAAGCCACATTATT Subject Seq: CP031332.1 BLASTn returns a single hit to CP031332.1 with query coverage at 100%. However if one looks at the alignment, ...
2
votes
1answer
50 views

NCBI blast for exact match of a short sequence

I'm trying to Blast for exact matches to the sequence: 'ATTGNNNNGCAAACCA' in the human transcriptome using NCBI Blast on its 'refseq_rna' database. However, when I do a basic query I get "No ...
0
votes
1answer
50 views

Does NCBI's blast API block my IP?

I am trying to run a blatn command from both my laptop and within a google colab notebook. I am not sure why, but this command runs properly once and then, on the ...
0
votes
0answers
16 views

How to interpret column 'N' in tblastx output?

My understanding from this page https://www.biostars.org/p/272364/ is that it's related to 'High Scoring Pairs', which are in turn related to the way BLAST works. I'm still not sure how to interpret ...
0
votes
0answers
16 views

Blast templates not found in PSI-TM Coffee

I'm trying to run psicoffe mode on Ubuntu 18.04, but it returns the error: 17633 -- WARNING: Impossible to find BLAST Templates Check that your blast server is properly installed [See documentation][...
3
votes
2answers
71 views

How to find possible viral subsequences in a Eukaryote genome?

I have an assembly of an algae and want to find if it has anything analogous to endogenous retroviruses' subsequences in its DNA. My guess is I should manually blastn all subsequences until I find (or ...
2
votes
2answers
44 views

Software for taxonomic assignment?

I have a couple of hundred bacterial sequences of 2-30 genes of interest each, recovered from metagenomics. None of them encode rRNA. Normally I'd just BLAST the one gene I already know to be reliable ...
2
votes
2answers
481 views

how to have a blast xml file in a readable and understandable way

I got a blast xml file after a DNA sequence search. The XML file is not very readable. What is the way to make it more understandable? This blast contains about twenty matches. Here is the xml file
1
vote
1answer
69 views

Do you know a program/script to count how many sequences have mismatches on each position of my primers?

I'm working with primer analysis and design, and so far I've performing it in Excel but: a) I don't like Excel, b) I do it manually, c) I don't like Excel, d) it gets tedious when working with ...
0
votes
0answers
29 views

Command-line blastn not responding; trace says “Resource not available”

I hadn't used the NCBI command-line tools for a while, and just got back into it. But no matter where or how I run blastn now, I get an almost complete lack of response: just the initial "BLASTN ...
0
votes
0answers
37 views

BLAST, last step: Needleman-Wunsch + S-score

In my bioinformatics course we studied the BLAST agorithm. After finding the HSP's and joining the HSPs together that are close enough and in a correct diagonal trend, we perform a next step: namely a ...
0
votes
0answers
15 views

Getting BLAST to show similar sequences outside of a specific protein family

I'm trying to build an alignment of proteins in the major facilitator superfamily (MFS). I have alignments of a family of peptide transporters, the SLC15 family, but I would now like to extend the ...
1
vote
1answer
112 views

Blast results filters

I performed a blastn search of NGS data against ssRNA database download from Internet, with a expected value 10-4. The size of NGS data reads is of 125 bp. I have analyzed the blast results of the ...
0
votes
1answer
37 views

Standalone Blast+; Automating searches, Blastn formatting, interpretation

I am struggling with using NCBI's standalone blast, particularly the blastn feature. I have a large number of nucleotide sequences that I want to use blastn to ID. The goal is to retrieve information ...
1
vote
0answers
55 views

Analyzing a blast result of NGS data

I am analyzing BLAST results from total RNA NGS, pair ends. This BLAST results was performed against the ssRNA virus database download from NCBI. I filtered those read data whose paired ends ...
0
votes
0answers
26 views

Why is the output from the online DISOPRED portal and a local DISOPRED installation different?

I recently installed DISOPRED on a computer cluster to predict the intrinsic disorder in long (~800 residues) amino acid sequences. I followed instructions provided on an online blog, since I couldn't ...
-1
votes
1answer
27 views

Can you give me a detailed explanation about PrimeBlast?

I am trying to write a research paper on PRIMER-BLAST. I have read something about it on https://www.ncbi.nlm.nih.gov/pubmed/22708584/ but still, it is not enough. So can you please tell me more ...
0
votes
1answer
21 views

how could i find uniprot ac in blast?

I have made a search in p-blast. I would like to search for the protein results in uniprot. how can I do it directly? I can go to GENBANK but i would like to go to UNIPROT. Thank you!!!
1
vote
3answers
54 views

Primer-Blast Custom Database [error]

I'm using Primer-Blast to compare a PCR template against a custom database of reference sequences, using Primer-Blast's Custom database functionality. However whenever I try to upload a FASTA file as ...
0
votes
2answers
22 views

how can i search in p-blast against UNIPROT(not only swissprot)

i need to search for one protein against UNIPROT in BLAST for a selected organism. How can I do it? (SWSISSPROT+TREMBL) THANKS!!
2
votes
0answers
23 views

phmm blast hmmer

i have created a phmm in hmmer from a multiple alignment focused on E. coli produced in tcoffee from sequences taken from blast similar to my query sequence. I would like to ask how i can compare the ...
6
votes
2answers
653 views

BERT Language Model and Gene Sequences - How Do I Relate Clusters of Sequences?

I hope you'll indulge a question from a computer scientist with limited bioinformatics knowledge. I've been working with the Google tool for language modeling called BERT. It's generally regarded ...
2
votes
0answers
177 views

Cannot blast against specific NCBI databases

I am having issues with some prokaryote reference genome databases (exact names : ref_prok_rep_genomes.*), that I downloaded from the NCBI website : https://ftp.ncbi.nlm.nih.gov/blast/db/. Files in ...
2
votes
1answer
68 views

Possibility to save output blastn table in memory using biopython

Is there a possibility, using biopython to save output table of blastn in memory, not in file on hard drive, for process it using pandas for example and then delete it from memory? I mean, is there a ...
1
vote
1answer
144 views

How to do BLASTP for short sequences (<20 aa) effectively?

I am trying to find sequence homology between viral sequences and my protein of interest. I have the sequences of their epitopes which varies from 5 to 500 amino acids long. For shorter sequences, it ...
2
votes
1answer
695 views

Cannot blast database created with blastdb_aliastool: BLAST Database error: No alias or index file found

I want to merge/concatenate BLAST databases as suggested here. This is my example script that explains what I'm trying to achieve better than words can: ...
2
votes
1answer
60 views

Translating a genome sequence into possible frames

I have a sequence below from MYC gene about which I need to translate the sequence in all possible frames AND identify (for each frame) which codons are actually used in MYC ...
0
votes
1answer
43 views

how to generate structure file from blast results of an input sequence

I have tried to incorporate blast in my application using biopython.i could extract the blast results but now i want to extract the structure file corresponding matches. My code is : ...
4
votes
3answers
208 views

What are the different kinds of bioluminescent genes?

I know of the common green glow gene but I forgot the name and I also know that some algae glow blue. There are so many types of bioluminesent organisms, so I am wondering what species have which ...
2
votes
2answers
45 views

Is there a “definitive” database for Mobile Genetic Elements?

This isn't quite my speciality, but I've been tasked with finding any evidence of Mobile Genetic Elements (like transposable elements, retrotransposons, bacteriophages, etc.) within some WGS samples. ...
1
vote
0answers
18 views

How can I find genes of fundamental metabolic processes for an organism?

I want to find genes of fundamental metabolic processes in the Phytophthora cinnamomi genome. I'm using the genome sequence deposited in the NCBI and I'm searching ORF by ORF, using the ORF finder (...
2
votes
3answers
45 views

How to find a homolog that has a PDB structure available

I tried to find a homolog that has a PDB structure available so I can use this PDB file for comparative modeling. I ran a BLAST search but none of the search results seemed to have a known structure. ...
5
votes
1answer
160 views

which NCBI tool is optimized to identify a species from a DNA fragment?

“The Iceman” was a man who lived 5300 years ago and whose body was recovered from an Alpine glacier in 1991. Some fungal material was recovered from his clothing and sequenced. Ice man : found as a ...
1
vote
0answers
75 views

TBLASTN error: Too many positional arguments

I was running tblastn using standalone blast2.9.0+ through Ubuntu Linux, to get the alignment result of a list of protein sequences for same species, against its complete genome file. The command I ...
1
vote
1answer
199 views

Is there any tool for fuzzy sequence matching?

Note: this question was also asked on biostars are you aware of any tool that is able to perform error-tolerant pattern-matching search on protein FASTA files? For example, I want to know, which ...
0
votes
1answer
142 views

blast nt vs Genbank

What is the difference between these two databases? ftp://ftp.ncbi.nlm.nih.gov/blast/db/ and ftp://ftp.ncbi.nih.gov/genbank/ I understand that BLAST database has both nt for nucleotide and np for ...
1
vote
1answer
95 views

Plotting distance tree from blastn output

I'm trying to plot a simple distance tree of my blastn output with nj (like the tree view on NCBI). From what I understood, what I think I should do is extract all the hsps from each alignment re-...
2
votes
1answer
101 views

Appropriate tool or algorithm for sloppy alignment of degenerate bases

I have an optimization problem where I have a degenerate nucleotide sequence I want to align against subsets of a reference genome (exons, specifically, to make the problem more tractable). The ...
1
vote
1answer
36 views

Huge variability in blastn speed between same short sequence job

I have been running a couple of blast searches and I am very suprised and somewhat frustrated by the huge variability in job completion time. The specifics of my blast search are as follows: Running ...