Questions tagged [blastn]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1
vote
1answer
34 views

How to identify an unknow species from a fasta containing genetic sequences

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
1
vote
2answers
38 views

BLASTn query coverage discrepancy

Using the BLASTn webtool with, Query Seq: CAATTGCGAAGCCACATTATT Subject Seq: CP031332.1 BLASTn returns a single hit to CP031332.1 with query coverage at 100%. However if one looks at the alignment, ...
3
votes
2answers
66 views

How to find possible viral subsequences in a Eukaryote genome?

I have an assembly of an algae and want to find if it has anything analogous to endogenous retroviruses' subsequences in its DNA. My guess is I should manually blastn all subsequences until I find (or ...
0
votes
0answers
22 views

Command-line blastn not responding; trace says “Resource not available”

I hadn't used the NCBI command-line tools for a while, and just got back into it. But no matter where or how I run blastn now, I get an almost complete lack of response: just the initial "BLASTN ...
1
vote
1answer
84 views

Blast results filters

I performed a blastn search of NGS data against ssRNA database download from Internet, with a expected value 10-4. The size of NGS data reads is of 125 bp. I have analyzed the blast results of the ...
0
votes
1answer
26 views

Standalone Blast+; Automating searches, Blastn formatting, interpretation

I am struggling with using NCBI's standalone blast, particularly the blastn feature. I have a large number of nucleotide sequences that I want to use blastn to ID. The goal is to retrieve information ...
0
votes
1answer
947 views

local BLAST error: BLAST Database error: Error: Not a valid version 4 database

I want to use a local blastn command to BLAST a multifasta file ~700 sequences using following command: ...
2
votes
2answers
79 views

Downloading all COI sequences from BOLD fails

I have metabarcoding sequence data (COI) from bulk animal samples (including arthropoda, nematoda, annelida, mollusca) and I want to BLAST all of these sequences. I used following command to do this: <...
2
votes
0answers
85 views

Cannot blast against specific NCBI databases

I am having issues with some prokaryote reference genome databases (exact names : ref_prok_rep_genomes.*), that I downloaded from the NCBI website : https://ftp.ncbi.nlm.nih.gov/blast/db/. Files in ...
1
vote
1answer
60 views

using blastn to search [error]

so I'm fairly new to using linux and blast - have encountered an error in my work. I have created a fasta database with the results in this directory path: ...
0
votes
0answers
60 views

Wrong blast results

I'm sorry if this is a naive question, but I get an odd thing going on. I'm performing blast remotely in this way: ...
0
votes
0answers
20 views

exclude uncultured and environmental samples from NT databases [duplicate]

I'm using blast locally against NT databases and I'm excluding the uncultured and environmental samples by the taxonomy ID. Is there another way to exclude them entirely, without using the taxonomy ID?...
1
vote
4answers
70 views

Find indels between two short sequences

I have two sequences, say AAAGCTCGAGG and AAAGCGAGG. I need a convenient tool which shows me insertions or deletions between these, i.e. in this case something like ...
0
votes
1answer
104 views

blast nt vs Genbank

What is the difference between these two databases? ftp://ftp.ncbi.nlm.nih.gov/blast/db/ and ftp://ftp.ncbi.nih.gov/genbank/ I understand that BLAST database has both nt for nucleotide and np for ...
1
vote
1answer
90 views

Plotting distance tree from blastn output

I'm trying to plot a simple distance tree of my blastn output with nj (like the tree view on NCBI). From what I understood, what I think I should do is extract all the hsps from each alignment re-...
0
votes
2answers
66 views

Inferring a phylogenetic tree from BLASTn

I am trying to infer a phylogenetic tree from a Blastn output and from what I have understood, what I should do is 1) extract the alignments and re-align them using Muscle, then 2) feed the .aln file ...
2
votes
1answer
86 views

Appropriate tool or algorithm for sloppy alignment of degenerate bases

I have an optimization problem where I have a degenerate nucleotide sequence I want to align against subsets of a reference genome (exons, specifically, to make the problem more tractable). The ...