Questions tagged [blastn]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1 vote
0 answers
55 views

Blastn locally nt database search length < 16

when I run a short search in blastn locally with less than 16 nucleotides with nt.00 database I don't get any found match, but if I increase the searched string 2 nucleotides it finds matches, so the ...
user avatar
1 vote
2 answers
79 views

Do I have to download all nt.xx files to perform a search in blastn 2.12.0

I downloaded and extract blast nt.24 database, but when I run : blastn -task blastn-short -query consulta.fa -db nt.24 -out misalida.txt it says: mdb_env_open: No such file or directory and if a try ...
user avatar
2 votes
1 answer
33 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
user avatar
  • 249
1 vote
0 answers
23 views

Finding annotated counterpart after BLASTn with efetch (Biopython)

I am creating a pipeline for the identification of unknown transcripts. After a local BLASTn search of the transcripts, I have a large list of the respective hits with different genomes. I have the ...
user avatar
  • 26
0 votes
0 answers
22 views

How to assess how prone genes may be to acquire structural polymorphisms?

I have 5 strains of P.falciparum. Each FASTA file has all its annotated CDSs. After a first pre-processing phase, where I eliminated the strangest sequences (perhaps the longest or shorter ones, which ...
user avatar
2 votes
0 answers
51 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
user avatar
  • 41
1 vote
1 answer
79 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
user avatar
  • 13
1 vote
2 answers
140 views

BLASTn query coverage discrepancy

Using the BLASTn webtool with, Query Seq: CAATTGCGAAGCCACATTATT Subject Seq: CP031332.1 BLASTn returns a single hit to CP031332.1 with query coverage at 100%. However if one looks at the alignment, ...
user avatar
  • 249
3 votes
2 answers
72 views

How to find possible viral subsequences in a Eukaryote genome?

I have an assembly of an algae and want to find if it has anything analogous to endogenous retroviruses' subsequences in its DNA. My guess is I should manually blastn all subsequences until I find (or ...
user avatar
1 vote
1 answer
158 views

Blast results filters

I performed a blastn search of NGS data against ssRNA database download from Internet, with a expected value 10-4. The size of NGS data reads is of 125 bp. I have analyzed the blast results of the ...
user avatar
0 votes
1 answer
54 views

Standalone Blast+; Automating searches, Blastn formatting, interpretation

I am struggling with using NCBI's standalone blast, particularly the blastn feature. I have a large number of nucleotide sequences that I want to use blastn to ID. The goal is to retrieve information ...
user avatar
  • 1
1 vote
1 answer
4k views

local BLAST error: BLAST Database error: Error: Not a valid version 4 database

I want to use a local blastn command to BLAST a multifasta file ~700 sequences using following command: ...
user avatar
  • 123
3 votes
2 answers
471 views

Downloading all COI sequences from BOLD fails

I have metabarcoding sequence data (COI) from bulk animal samples (including arthropoda, nematoda, annelida, mollusca) and I want to BLAST all of these sequences. I used following command to do this: <...
user avatar
  • 123
2 votes
0 answers
426 views

Cannot blast against specific NCBI databases

I am having issues with some prokaryote reference genome databases (exact names : ref_prok_rep_genomes.*), that I downloaded from the NCBI website : https://ftp.ncbi.nlm.nih.gov/blast/db/. Files in ...
user avatar
1 vote
1 answer
201 views

using blastn to search [error]

so I'm fairly new to using linux and blast - have encountered an error in my work. I have created a fasta database with the results in this directory path: ...
user avatar
  • 11
0 votes
0 answers
68 views

Wrong blast results

I'm sorry if this is a naive question, but I get an odd thing going on. I'm performing blast remotely in this way: ...
user avatar
  • 341
0 votes
0 answers
21 views

exclude uncultured and environmental samples from NT databases [duplicate]

I'm using blast locally against NT databases and I'm excluding the uncultured and environmental samples by the taxonomy ID. Is there another way to exclude them entirely, without using the taxonomy ID?...
user avatar
  • 341
1 vote
4 answers
73 views

Find indels between two short sequences

I have two sequences, say AAAGCTCGAGG and AAAGCGAGG. I need a convenient tool which shows me insertions or deletions between these, i.e. in this case something like ...
user avatar
0 votes
1 answer
240 views

blast nt vs Genbank

What is the difference between these two databases? ftp://ftp.ncbi.nlm.nih.gov/blast/db/ and ftp://ftp.ncbi.nih.gov/genbank/ I understand that BLAST database has both nt for nucleotide and np for ...
user avatar
1 vote
1 answer
142 views

Plotting distance tree from blastn output

I'm trying to plot a simple distance tree of my blastn output with nj (like the tree view on NCBI). From what I understood, what I think I should do is extract all the hsps from each alignment re-...
user avatar
0 votes
2 answers
125 views

Inferring a phylogenetic tree from BLASTn

I am trying to infer a phylogenetic tree from a Blastn output and from what I have understood, what I should do is 1) extract the alignments and re-align them using Muscle, then 2) feed the .aln file ...
user avatar
2 votes
1 answer
174 views

Appropriate tool or algorithm for sloppy alignment of degenerate bases

I have an optimization problem where I have a degenerate nucleotide sequence I want to align against subsets of a reference genome (exons, specifically, to make the problem more tractable). The ...
user avatar