Questions tagged [blastn]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
3
votes
2answers
71 views

How to find possible viral subsequences in a Eukaryote genome?

I have an assembly of an algae and want to find if it has anything analogous to endogenous retroviruses' subsequences in its DNA. My guess is I should manually blastn all subsequences until I find (or ...
2
votes
2answers
276 views

Downloading all COI sequences from BOLD fails

I have metabarcoding sequence data (COI) from bulk animal samples (including arthropoda, nematoda, annelida, mollusca) and I want to BLAST all of these sequences. I used following command to do this: <...
2
votes
1answer
125 views

Appropriate tool or algorithm for sloppy alignment of degenerate bases

I have an optimization problem where I have a degenerate nucleotide sequence I want to align against subsets of a reference genome (exons, specifically, to make the problem more tractable). The ...
2
votes
1answer
24 views

blastn returning an inferior alignment

In my work I've found that in circumstances where there is a mismatch near the edges of the query sequence, blastn prefers to return a shorter contiguous alignment, rather than allowing for a mismatch ...
2
votes
0answers
42 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
2
votes
0answers
275 views

Cannot blast against specific NCBI databases

I am having issues with some prokaryote reference genome databases (exact names : ref_prok_rep_genomes.*), that I downloaded from the NCBI website : https://ftp.ncbi.nlm.nih.gov/blast/db/. Files in ...
1
vote
1answer
3k views

local BLAST error: BLAST Database error: Error: Not a valid version 4 database

I want to use a local blastn command to BLAST a multifasta file ~700 sequences using following command: ...
1
vote
1answer
148 views

using blastn to search [error]

so I'm fairly new to using linux and blast - have encountered an error in my work. I have created a fasta database with the results in this directory path: ...
1
vote
1answer
58 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
1
vote
2answers
69 views

BLASTn query coverage discrepancy

Using the BLASTn webtool with, Query Seq: CAATTGCGAAGCCACATTATT Subject Seq: CP031332.1 BLASTn returns a single hit to CP031332.1 with query coverage at 100%. However if one looks at the alignment, ...
1
vote
1answer
133 views

Blast results filters

I performed a blastn search of NGS data against ssRNA database download from Internet, with a expected value 10-4. The size of NGS data reads is of 125 bp. I have analyzed the blast results of the ...
1
vote
4answers
72 views

Find indels between two short sequences

I have two sequences, say AAAGCTCGAGG and AAAGCGAGG. I need a convenient tool which shows me insertions or deletions between these, i.e. in this case something like ...
1
vote
1answer
105 views

Plotting distance tree from blastn output

I'm trying to plot a simple distance tree of my blastn output with nj (like the tree view on NCBI). From what I understood, what I think I should do is extract all the hsps from each alignment re-...
1
vote
0answers
20 views

Finding annotated counterpart after BLASTn with efetch (Biopython)

I am creating a pipeline for the identification of unknown transcripts. After a local BLASTn search of the transcripts, I have a large list of the respective hits with different genomes. I have the ...
0
votes
1answer
48 views

Standalone Blast+; Automating searches, Blastn formatting, interpretation

I am struggling with using NCBI's standalone blast, particularly the blastn feature. I have a large number of nucleotide sequences that I want to use blastn to ID. The goal is to retrieve information ...
0
votes
1answer
184 views

blast nt vs Genbank

What is the difference between these two databases? ftp://ftp.ncbi.nlm.nih.gov/blast/db/ and ftp://ftp.ncbi.nih.gov/genbank/ I understand that BLAST database has both nt for nucleotide and np for ...
0
votes
0answers
5 views

Do I have to download all nt.xx files to perform a search in blastn 2.12.0

I downloaded and extract blast nt.24 database, but when I run : blastn -task blastn-short -query consulta.fa -db nt.24 -out misalida.txt it says: mdb_env_open: No such file or directory and if a try ...
0
votes
0answers
20 views

How to assess how prone genes may be to acquire structural polymorphisms?

I have 5 strains of P.falciparum. Each FASTA file has all its annotated CDSs. After a first pre-processing phase, where I eliminated the strangest sequences (perhaps the longest or shorter ones, which ...
0
votes
0answers
65 views

Wrong blast results

I'm sorry if this is a naive question, but I get an odd thing going on. I'm performing blast remotely in this way: ...
0
votes
0answers
20 views

exclude uncultured and environmental samples from NT databases [duplicate]

I'm using blast locally against NT databases and I'm excluding the uncultured and environmental samples by the taxonomy ID. Is there another way to exclude them entirely, without using the taxonomy ID?...
0
votes
2answers
110 views

Inferring a phylogenetic tree from BLASTn

I am trying to infer a phylogenetic tree from a Blastn output and from what I have understood, what I should do is 1) extract the alignments and re-align them using Muscle, then 2) feed the .aln file ...