Questions tagged [blat]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1
vote
0answers
26 views

setting BLAT alignment parameters to give long matches

I'm using BLAT to align DNA sequences between similar species, and having trouble setting the parameters to return only significant matches along the 50bp query lengths. Using ...
4
votes
1answer
206 views

Can blat use more than one core/CPU to speed up the alignment?

I am using BLAT to align two versions of the genome of C. elegans. I can see in the Activity Monitor of my Mac Book Pro High Sierra that blat is using 100% of a CPU....
4
votes
1answer
110 views

Using large databases with BLAT

I'm a computer scientist working with biologists at a small school that doesn't have dedicated bioinformatics staff. I apologize if I use incorrect terminology since I have limited bioinformatics ...
4
votes
1answer
395 views

Using BLAT command line tool to blat split sequences

I have the nucleotide sequence: AATTGAGGCACATTTTTTTTTAGACAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATCATAGCTCACTGCAGCCTCGACCTCCTGGGCTCAACAAAGCACACAGTGGGCGGATCCCCACCAG When I blat this on UCSC Genome ...
7
votes
2answers
367 views

Understanding the significance of BLAT score calculations for read fragment alignment

I'm attempting to reconstruct the read fragments that form a hit to a target, excluding/skipping gaps. BLAST's outfmt 6, and alternatives such as Diamond's ...