Questions tagged [dna]

Acronym for deoxyribonucleic acid, the unit of inheritance for all eukaryotic and prokaryotic organisms

Filter by
Sorted by
Tagged with
3
votes
1answer
65 views

Why does the SARS-Cov2 genome has letter t

ATTAAAGGTT TATACCTTCC CAGGTAACAA ACCAACCAAC TTTCGAT... is genome of an RNA virus SARS-Cov-2. RNA contains letters C+...
1
vote
2answers
112 views

Compressing the human genome to few megabytes

Multiple sources (see for instance this or this) discuss how genetic data will have scalability problems, given the huge file size of the human genome. The most straightforward encoding (see here) of ...
-1
votes
1answer
26 views

What is meant by transcriptional changes executed by the cell over a time period?

I read the following line in the research paper - The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells: During differentiation, for example, each ...
1
vote
1answer
87 views

Problem with classification model of genomic data: every machine learing model predicts wrongly almost always the same subset of dataset

First of all, I'd like to apologize for any spelling or grammar mistakes. I'm having a problem using R for a classification problem. My dataset contains ~300.000 genomic data, and the features are ...
1
vote
1answer
49 views

Translate all reads in a .fastq into protein sequence from deep mutational scanning experiment

I'm working with paired-end NGS reads from an Illumina platform. The sequences I have are all of the same gene, but have one or more substitution mutations each. Here is a rough workflow for ...
1
vote
1answer
14 views

Encoding different DNAs in pySBOL3?

I want to encode two different DNAs using pySBOL3. First dna is an engineered region usually composed by a transcriptional unit (TU) or a set of TUs. The second is vector which is a basically a ...
0
votes
0answers
43 views

How likely is it to find primers sequences in already-trimmed reads?

So, I am analysing 18S amplicon data (fastq files) to be able to eventually investigate the taxa composition. After removing primers (using cutadapt) from both R1 ...
1
vote
1answer
30 views

Output of allelic association doesn't write the rsID

I'm using plink (1.9b5) to do allelic association. My problem is that my output does not write the rsID (SNP), it just writes a dot. Output: ...
0
votes
1answer
29 views

How to know if the DNA sequence has been assembled and why is it important to know how it was assembled?

I have downloaded my FASTA format files, that have the DNA sequences of the coding region of the genes and the DNA sequence of the complete genome, from NCBI. How can I recognize if these sequences ...
4
votes
1answer
119 views

Are there computational tools to extract features of DNA sequences?

I am looking for tools to extract features from short DNA sequences. For example, entropy, complexity, GC-content, etc. I have found the generateFeatures.py script from the PyFeat repo, but is there ...
2
votes
2answers
55 views

What is the file .mums created by mummer?

I am doing genome sequence alignment using MUMmer, in particular I want to do a dotplot with mummerplot. So the passages that I did are: 1.create a file .mums with the following command line: ...
7
votes
2answers
332 views

Theoretical limit of human genome compression

How small can a compressed file containing the human genome be? I'm aware that this question cannot actually be answered, since it is asking for the Kolmogorov complexity of the human genome, which is ...
1
vote
2answers
69 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
0
votes
1answer
41 views

How to compute a p-value for the similarity measurement of two DNA sequences/contigs?

I'm attempting to come up with a statistical model to determine the p-value for the similarity value $ 0 \le s \le 1 $ of two DNA contigs. The idea is to get a numerical measure to estimate if two ...
1
vote
0answers
15 views

How to interpret complete genome sequence in NCBI

I have a very basic and quick question: does the complete sequence of nucleotides of an organism (for example this one that I am considering in my homework of Pyrococcus Fuoriosus) reported in NCBI ...
2
votes
1answer
55 views

Shannon's Entropy and DNA

I have been working with Shannon's entropy (SE) and DNA lately, and referring to the formula and concept of SE, I just wondered whether one should in the case of DNA use each nucleotide as having a ...
1
vote
2answers
119 views

Fastq: how can I check if they are from DNA or RNAseq data?

I have (gave me) Illumina fastq files, which I want to use for variant calling, and I do not know if they are DNAseq or RNAseq data. How can I check this? I do not have any report or who to ask. Many ...
2
votes
4answers
162 views

What are the applications of DNA or RNA pattern matching? [closed]

I'm assuming we don't do pattern matching in DNA or RNA for the fun of it. So I'd like to know what are the applications of pattern matching or where does it fit in in larger applications? I'm a ...
2
votes
0answers
17 views

Tajima-Nei Distance estimate with BioPerl

I have been trying to estimate Tajima-Nei distance for my data (link below). I´m following this protocol from BioPerl: https://metacpan.org/pod/Bio::Align::DNAStatistics I have 314 sequences in a ...
2
votes
1answer
54 views

How can I use my Myheritage DNA results file for further analysis?

I had my DNA tested by Myheritage and they sent me a csv file with RSID, Chromosome, position and result (which base) with about 700,000 rows. I understand most analyses of DNA use VCF files but is ...
0
votes
0answers
86 views

Convert DNA raw data between a different formats [duplicate]

I have .vcf file with partly decoded genome provided by some service. How can I convert this file into other popular formats which may be used in other services? I'...
0
votes
1answer
29 views

Dataset showing evolution of gene

As a way to exemplify how the hierarchical clustering of particular DNA sequences can be used to derive phylogenetic trees, I'm looking for a (even very small) dataset of the same genes (or other ...
9
votes
3answers
3k views

What is a quick way to find the reverse complement in bash

I have a DNA sequence for which I would like to quickly find the reverse complement. Is there a quick way of doing this on the bash command line using only GNU tools?
-3
votes
1answer
41 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
0
votes
0answers
42 views

Pairwise alignment using CIGAR String

I want to perform pairwise alignment and get the resulting CIGAR string. The channel can emit insertions, deletions and substitution errors. For example, if the input was AAGCT Then the output could ...
0
votes
0answers
23 views

DNA sequence error annotation

Suppose I generate a DNA sequence of the following pattern. AAGTC And after being passed through a channel with insertion, deletion and substitution errors obtain the following sequence AAAGGC Where ...
5
votes
3answers
1k views

How to translate amino acid sequences to Nucleotide sequences

I want to convert a list of fasta ( protein sequences) in a .text file into corresponding nucleotide sequences. A Google search gives me result of DNA to protein conversion but not vice versa. Also, I ...
1
vote
0answers
23 views

How can I get the estimate of lmFit function form limma package

This is the first time that I used lmfit function from the limma package I'm a little bit confused on how to interpret the result. is there a way to get the ...
0
votes
1answer
74 views

How to concatenate two fasta sequences by py

I have three backbone and i want to concatenate 70 sequence into these backbone. such like: fasta file 1: ...
1
vote
2answers
41 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
20
votes
8answers
8k views

What is the fastest way to get the reverse complement of a DNA sequence in python?

I am writing a python script that requires a reverse complement function to be called on DNA strings of length 1 through around length 30. Line profiling programs indicate that my functions spend a ...
1
vote
1answer
46 views

Get raw genome sequence

I'm currently working on testing some matching algorithms for strings. I would like to do some tests on raw genomic data as I expect different results from random strings given the lower entropy. How ...
0
votes
1answer
109 views

Reading fasta sequence regions with faidx

Im coding in c++ and reading in different reference genomes to examine regions across the chromosomes a few hundred basepairs at a time. To do it in c++ i use the library htslib and the command ...
2
votes
1answer
55 views

Mining documents for nucleotide and peptide sequences

The text mining literature has an emphasis on identifying and normalizing gene names, mutations, pathways, concepts, and so on. I haven't been able to find much, however, on methods for extracting ...
0
votes
1answer
78 views

Help Adjusting Bedtools Output in R

I have been asked to write a script in R to edit, using data.frame, this .fa file that is the result from extracting gene sequences from a repeat masker coordinate file on the genome I am working with....
1
vote
1answer
25 views

How can I run the fdnadist command from the EMBOSS package?

My operating system is Mac OS X. I would like to compute DNA distances between different sequences. For this, the dnadist package from the Phylip software would be good but hard to automate. EMBOSS ...
0
votes
1answer
41 views

BioJava - Protein to DNA

Using Biojava 5, I am trying to convert a sequence of Amino Acids to a Nucleotide sequence. Any idea how to do this?
6
votes
1answer
336 views

Biohackers Netflix - DNA to binary and video

I'm not sponsored or anything, just interested in their challenge to decipher their DNA code. They encoded their first episode of "Biohackers" video/binary file to DNA code and said if we ...
0
votes
2answers
57 views

How to modify DNA evolution model to fit actual data?

I'm working on understanding the evolution of a gene in a phylogenetic tree. I know the rates of evolution of each organism (from the tree). I am taking a random DNA sequence with my gene, evolving it ...
1
vote
0answers
20 views

mining DNA barcodes from Genebank/BOLD per location

Is there a method to download all the sequences for a particular geographic region (Panama) for 'DNA barcode' sequences (ITS2, rbcL or trnL). Hopefully, the specimen collection location will include ...
0
votes
0answers
22 views

Greedy Motif Search [ Reasoning ]

I was able to execute the algorithm correctly. But I'm still trying to get a hold of the result I'm achieving. This is the algorithm I'm trying to understand - http://rosalind.info/problems/ba2d/ If ...
1
vote
1answer
125 views

Need a alternative or more complex version of venn diagram in python for matching dna sequences

I am in google colab and I have combined and set up a data frame list of sequences that goes like this Location ID Sequence 1.1 ........ A ........ AAGAGATA 1.2 ........ A........... ...
0
votes
2answers
49 views

Transcribing DNA exons and append transcripts into a list

I am trying to find a way to read and transcribe a list of DNA sequences (list of lists) only when the for loop finds a start codon (triplet of the list items) and until it finds a stop codon, over ...
8
votes
2answers
1k views

What is 'k' in sequencing?

When a DNA sequence is sequenced, I've only ever dealt with A,T,C,G and N which indicates un-identifiable bases. However, I came across a 'k' recently and I had asked another researcher who gave me an ...
1
vote
0answers
36 views

"How the clustal omega can be reverse engineered, to trace ancestral inversion mutations via the guide tree?"

I apologise for very basic question but I am very new to biology and have very specific knowledge of this field, I am currently working on Bioinformatics in my machine learning project which is why I ...
4
votes
1answer
436 views

How to map short sequences to long reads, recovering all multiply-mapped high-quality matches

The dilemma: I have around one million short sequences (21 bp to several 100s of basepairs) for which I need to identify all occurrences of in 20-30x coverage noisy long reads (both pacbio and ONT). ...
2
votes
0answers
31 views

Alignment using secondary and tertiary features of DNA

I m trying to align different sequences of length not greater than 50 bp. Could I incorporate additional information such as stacking energy, entropy, bonds etc as additional criteria in the alignment?...
3
votes
1answer
1k views

Searching for start and stop codons for protein sequencing of contigs

I need to convert contigs into their respective protein sequences given a reference genome (i.e. I need to take a substring, whose position is already known on the string, and I need to locate the ...
1
vote
1answer
37 views

DiffBind, diffferentially binding site

I have data for 3 histone marks (2 for silencing and 1 for activation) each mark has three replicates. when I run the diffBind package I have three contrast: ...
0
votes
0answers
37 views

Coding vs non-coding DNA length

I am trying to calculate the total exonic length (in bp) in order to see where the coding-noncoding ratio of roughly 1% to 99% comes from. We know all chromosomes total about 3 billion base pairs. So ...