Questions tagged [fasta]

To be used for questions specific tothe sequence file format `.fasta`. Please minimise usage if the question is more generally about sequence formats.

Filter by
Sorted by
Tagged with
4
votes
3answers
256 views

removing duplicate fasta sequence based on header with bash

I used the following command to remove duplicate fasta sequence based on header sequence: ...
1
vote
0answers
31 views

Combine two alleles to genotype locus?

I have a following fasta (produced by stacks populations): ...
1
vote
1answer
41 views

Biopython BioSQL error : AttributeError: 'DBSeq' object has no attribute '_data'

Hi I am playing with Biopython and BioSQL, I manage to create an MySQL database using Managing local biological databases with the BioSQL module tutorial: and load 2909 fasta sequences in it through: <...
0
votes
1answer
38 views

Converting FASTA Sequences to SNP FASTA Format

I have two FASTA sequences. Each is from a different species' mitochondrial genome. The sequences are pasted below. ...
0
votes
2answers
79 views

Remove Redundant Sequences from FASTA file with Biopython reducing memory footprint

I need help with my Biopython code, I am kind of new to Python and Biopython so please don't be harsh on me. Everything started from here: Remove duplicated sequences in FASTA with Python I answered ...
0
votes
1answer
27 views

Extract features from fasta sequences and train the classifier

I am new to the bioinformatics field. I have positive and negative protein sequences for acetylation PTM. Now, I want to train a classifier, say SVM. What will be the next step? How can I convert ...
-1
votes
1answer
48 views

Find species from FASTA files

In a school project we got the task of finding the species from two FASTA files. We got some hints of what to look for, like it is a unicellular eukaryote and that we can use blast. We don't know if ...
1
vote
3answers
106 views

Filtering Sequences (entries) by headers ID from a Fasta file database

First of all, sorry if this question has been posted previously (I could not found a solution accessing the previous Q&A). I have a fasta file as follow: ...
-3
votes
1answer
37 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
0
votes
3answers
26 views

Genome QC + Assembly Pipeline semantics

I’m trying to create a pipeline for genome assembly. How best can I “redirect/pipe” from existing fasta files (or files in general) to other steps of the pipeline? I was thinking of going from the SRA ...
1
vote
1answer
23 views

How to get matching pattern along with ID in a single command in grep?

I have a file containing multiple fast sequneces. For a specific consensus pattern as input, I extracted all the matching patterns from target fasta sequences with ...
1
vote
1answer
56 views

How to write multi-sequence alignment data frame as a fasta format fast

I have a data frame where the row names are the species names, and each column can either be an Amino-Acid character or "-". I wish to write it in a fasta format. Simple example of the ...
2
votes
0answers
40 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
-1
votes
1answer
99 views

Biopython SeqIO check input file

Hi I am trying to learnt python3 and Biopython, I am trying to check imported fasta file before processing so far using: ...
-1
votes
1answer
54 views

Metagenome simulation from a concatenated FASTA file

I am trying to simulate metagenome sequencing. So I will start with a file with a lot of concatenated genomes. From there, I would like to randomly extract 10,000 sequences of length 200bps. I got ...
1
vote
1answer
30 views

Metagenomics: Identifying most common sequences

I am working on a project and used the following command: ...
1
vote
3answers
255 views

Convert a fasta file to Newick format

My problem is (should be) pretty simple. I have a series of 10 sequences which I wish to convert into a Newick format file - what would be good software to do this? I've tried using Jalview and am ...
0
votes
2answers
26 views

FASTA and PDB: How to specify chain?

For proteins that have multiple chains (e.g., 1EMS), is there an easy way to specify which chain I want to use for blastp? I cannot imagine that I am the first person to have this problem, but so far ...
1
vote
2answers
122 views

How to replace sequence identifiers in a fasta with OTU IDs from another file?

I'm pretty new to Unix and bioinformatics and having a hard time accomplishing the following. I have one FASTA file with sequences and headers, and one OTU ID mapping file (.txt) with OTU IDs and ...
1
vote
5answers
123 views

How to remove duplicates from a fasta file using python

I am using the following command: ...
0
votes
2answers
42 views

How to obtain desired output?

I am working on a project using the following command within nano: ...
0
votes
2answers
48 views

How to fix NameError?

I am working on a project and am having issues with the following code that I have written in nano: ...
1
vote
1answer
21 views

Convert sequence in MS doc to fasta or genbank

How can I convert a sequence provided in a Microsoft doc file into a fasta or genbank format?
1
vote
1answer
42 views

Is there a simple command for outputting a tab delimited columns?

I am working on a fasta file and am writing my command in nano within command-line and executing using python, also within a command line. My objective is to get my command to provide me with a tab ...
1
vote
2answers
41 views

Extract sequences from MultiFASTA aligned file, by coordinates

I am trying to extract a specific sequence from a multifasta file, from each sequence in the aligned file. The sequences look like this, and there are 32 sequences within the multiFASTA: ...
0
votes
1answer
87 views

How to find the number of contigs produced? N50 length in base pairs? N90 length in base pairs?

I am having trouble with some underlying questions about my project. I have ran a Trinity tool to create a trinity.fasta file. To determine some underlying questions, I used the utility asm_stats to ...
1
vote
1answer
42 views

Get raw genome sequence

I'm currently working on testing some matching algorithms for strings. I would like to do some tests on raw genomic data as I expect different results from random strings given the lower entropy. How ...
-1
votes
1answer
20 views

How to identify to each scaffold a read belongs to, inside a .sam file?

I have a fasta file assembly and combining it with the raw reads we produced a .bam file which I converted to .sam . The .sam information lines look like this: ...
0
votes
0answers
39 views

Python/Biopython - Replace amino acid residue on MSA with “z” from a list of unaligned positions

I'm trying to programmatically replace a set of amino acid residues on an MSA with a "Z" from a list of unaligned positions. Any ideas on how I could do this? Input: a list of unaligned ...
0
votes
0answers
36 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
1
vote
1answer
41 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
1
vote
1answer
32 views

Add segregating sites to branches of a tree

I'm trying to figure out how I would plot a tree with number of segregating sites on display on the branches I'm using acctran from phangorn to plot a parsimony tree (using phydat object from fasta ...
-3
votes
2answers
55 views

get sequences begining with TA [closed]

I have a fasta file and the sequences in them are arranged like this: ...
0
votes
0answers
28 views

Why do I get cytosine to guanine/adenine transitions in bisulphite treated sequences?

I got my sequencing results (bisulphite treated and non treated sequences of same species Allium cepa) and now I have to do analysis in Cymate online tool. I prepared all sequences as it is written in ...
0
votes
3answers
60 views

Get gene sequence based on the annotation

I've got the reference genome with Python like so: ...
2
votes
2answers
156 views

Understanding the fasta File Format

I'm a computer scientist teaching algorithms development in the Fall. One of the algorithms we teach is called Edit Distance, and our folklore is that it is used to compare RNA sequences (is this ...
1
vote
1answer
131 views

Split fasta file based on groups in header information and output as separate files

I have a fasta file containing the sequence of a gene across different species. In total there are around 900 samples and 12 species. (Each sequences is over multiple lines and longer than 100bp.) My ...
0
votes
2answers
47 views

Basic question about finding mRNA sequence in transcriptome

I am a computer scientist just starting out in bioinformatics topics, and would appreciate any guidance that can be given here: I have an mRNA sequence- an isoform - whose length is about 4000 base ...
0
votes
1answer
26 views

Calculating Isoelectric point from a multifasta file

I need to calculate Isoelectric point from a multifasta file, is there any python code or web tool that allows me to do that?
0
votes
1answer
41 views

How do I get repeating regions from fasta file or directly from internet

If I go to ncbi site, apply customize view -> Customize -> All features -> Update view and then ctrl + f : Alu I can ...
0
votes
2answers
110 views

Python: How to write duplicate sequences removed from fasta file to new file

I currently am using this code to remove duplicate sequences from the fasta file. However, I would also like to write a new file with only the removed duplicates as well as a count for how many times ...
0
votes
1answer
160 views

Remove Redundant Sequences from FASTA file in Python

I'm attempting to remove redundant sequences from a fasta file (from NCBI). When I execute this code, it returns the number of spots, not the number of sequences. (Number of spots: 408,293, Number of ...
0
votes
0answers
25 views

How to compare 2 AGTC sequences of homo sapiens and pan troglodytes?

I'm the beginner and I want to compare DNA of Homo sapiens and Pan troglodytes. I have taken files from here and downloaded homo sapiens primary assemmly file and pan troglodytes toplevel file, but ...
-1
votes
1answer
972 views

What is the full script to extract sequences from fasta file by using Ids in text file in python 3 and pycharm?

I have a fasta file (gene.fasta)with sequences with names patterns: ...
2
votes
1answer
233 views

Converting aligned fasta to plink ped/bed

I have an alignment of multiple sequences in a FASTA file (output from MAFFT), for which I would like to simulate a phenotype using plink, but for that I need to have my alignment in a PED file or ...
1
vote
0answers
85 views

Is there a FASTA Sequence Description Nomenclature to Indicate a Split Sequence or Subsequence?

I have a nucleotide sequence where I am interested in aligning reads distinctly to one or another portion of the sequence. However, I would like to use a visualization tool such as IGV to view these ...
1
vote
4answers
1k views

Edit FASTA header using sed

I need to rename the following headers from a FASTA file. Something like: ...
0
votes
1answer
102 views

How can i modify FASTA headers in a multi fasta file using BioPython SeqIO

I have a multi fasta file similar to this (relatively new here so uncertain of best way to present this; I have gone for an output and the code i used to make it - belt and braces...): ...
2
votes
4answers
74 views

Separate multiple sequence into different file, one sequence per file

I have a file contain multiple sequence, and I want to separate them by "gene:" into different file. example: example.fa ...
1
vote
1answer
451 views

remove sequences from fasta file matching a string in the header

I have a file with 16S sequences. some headers contain species information. For my purposes I would like to exclude a number of species from the file, therefore I would like to do a pattern matching ...