Questions tagged [fasta]

To be used for questions specific tothe sequence file format `.fasta`. Please minimise usage if the question is more generally about sequence formats.

Filter by
Sorted by
Tagged with
17 votes
12 answers
10k views

How to convert fasta file to tab delimited file

I have a fasta file like >sample 1 gene 1 atgc >sample 1 gene 2 atgc >sample 2 gene 1 atgc I want to get the following output, with one break between ...
AudileF's user avatar
  • 955
191 votes
4 answers
124k views

Why does the SARS-Cov2 coronavirus genome end in aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa (33 a's)?

The SARS-Cov2 coronavirus's genome was released, and is now available on Genbank. Looking at it... ...
Rebecca J. Stones's user avatar
21 votes
10 answers
7k views

What is the fastest way to calculate the number of unknown nucleotides in FASTA / FASTQ files?

I used to work with publicly available genomic references, where basic statistics are usually available and if they are not, you have to compute them only once so there is no reason to worry about ...
Kamil S Jaron's user avatar
18 votes
7 answers
16k views

How to convert FASTA to BED

I have a FASTA file: ...
SmallChess's user avatar
  • 2,699
34 votes
4 answers
9k views

Why does the FASTA sequence for coronavirus look like DNA, not RNA?

I'm looking at a genome sequence for 2019-nCoV on NCBI. The FASTA sequence looks like this: ...
jameshfisher's user avatar
14 votes
10 answers
3k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
SmallChess's user avatar
  • 2,699
3 votes
4 answers
426 views

How to programatically download SARS-CoV-2 fasta from NCBI/Genbank via API?

I would like to download a number of SARS-CoV-2 fastas from NCBI/Genbank using a web endpoint. I looked on their website but it's confusing. I have the accession numbers, but can't figure out how to ...
Cornelius Roemer's user avatar
0 votes
1 answer
1k views

Using Entrez.efetch() to retrive .fasta file from any NCBI database?

I tried to use these python codes to retrieve a .fasta file from gene database, but the output were the parameters of the report ...
DurianDan's user avatar
41 votes
4 answers
61k views

What is the difference between FASTA, FASTQ, and SAM file formats?

I'd like to learn the differences between 3 common formats such as FASTA, FASTQ and SAM. How they are different? Are there any benefits of using one over another? Based on Wikipedia pages, I can't ...
kenorb's user avatar
  • 1,293
27 votes
7 answers
9k views

Read length distribution from FASTA file

I have a single ~10GB FASTA file generated from an Oxford Nanopore Technologies' MinION run, with >1M reads of mean length ~8Kb. How can I quickly and efficiently calculate the distribution of read ...
Scott Gigante's user avatar
23 votes
4 answers
15k views

What Ensembl genome version should I use for alignments? (e.g. toplevel.fa vs. primary_assembly.fa)

When you look at all the genome files available from Ensembl. You are presented with a bunch of options. Which one is the best to use/download? You have a combination of choices. First part options: ...
story's user avatar
  • 1,573
13 votes
6 answers
405 views

Are there any databases of templates for common bioinformatic file formats?

I want some templates of different file formats that I can use to test my scripts and identify possible bugs in my code. For example, consider nucleotide FASTA, a simple but often abused format, I ...
Chris_Rands's user avatar
  • 3,948
11 votes
3 answers
7k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
ShanZhengYang's user avatar
11 votes
1 answer
3k views

Changing the record id in a FASTA file using BioPython

I have the following FASTA file, original.fasta: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need ...
BioGeek's user avatar
  • 496
9 votes
5 answers
4k views

How can longest isoforms (per gene) be extracted from a FASTA file?

Is there a convenient way to extract the longest isoforms from a transcriptome fasta file? I had found some scripts on biostars but none are functional and I'm having difficulty getting them to work. ...
ZincFingers's user avatar
9 votes
10 answers
24k views

Remove/delete sequences by ID from multifasta

I have a fasta file like this: >Id1 ATCCTT >Id2 ATTTTCCC >Id3 TTTCCCCAAAA >Id4 CCCTTTAAA I want to delete sequences that have the following IDs. <...
andresito's user avatar
  • 385
8 votes
4 answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
ShanZhengYang's user avatar
5 votes
2 answers
861 views

How can I locate duplicated regions in a sequence?

I am facing an issue when trying to align short reads against a region in human chr5. The two Sensory Motor Neuron genes, (SMN1 and SMN2) are almost 100% identical and this causes the aligner to fail ...
terdon's user avatar
  • 10.1k
5 votes
4 answers
3k views

How to map PDB chains to Uniprot IDs using API services

I have a lot of PDB IDs and I need to get uniprot fasta sequences of these PDB IDs special chains by API services. For example, imagine that I need to get fasta sequence of '1kf6' 'A' chain. The ...
Sara's user avatar
  • 777
5 votes
1 answer
174 views

Extracting sequences from FASTA beginning with common 5' end

I am trying to figure out the best way to extract sequences from a FASTA file which begin with a common 5' region of 43 nucleotides. Preferably, I would like to to allow for "fuzziness" in this region ...
hunter92's user avatar
5 votes
1 answer
898 views

Ancestry of the coronavirus 2019-nCov, WuHan city, China

In one of the answers to another question about the corona virus a link was given to this phylogenetic analysis of the virus. Can somebody assist a non-bio type here? It seems to show that the ...
puppetsock's user avatar
3 votes
1 answer
130 views

How to use the hmmsearch on prototypic repetitive sequences Repbase Update database?

I want to use the hmmsearch proposed in Convergence of retrotransposons in oomycetes and plants by Kirill Ustyantsev, Alexandr Blinov and Georgy Smyshlyaev. After the help from terdon I managed to ...
A.Dumas's user avatar
  • 497
2 votes
1 answer
814 views

Remove Redundant Sequences from FASTA file in Python

I'm attempting to remove redundant sequences from a fasta file (from NCBI). When I execute this code, it returns the number of spots, not the number of sequences. (Number of spots: 408,293, Number of ...
User's user avatar
  • 53
2 votes
3 answers
3k views

Filtering Sequences (entries) by headers ID from a Fasta file database

First of all, sorry if this question has been posted previously (I could not found a solution accessing the previous Q&A). I have a fasta file as follow: ...
Fabricio's user avatar
2 votes
1 answer
402 views

How to edit the headers of multiple fasta files from multiple folders?

My directories are organized as follows: one main directory, in which I have multiple directories that end with a number ranging from 314 to 727, followed by .3 . For example, 'mgm4761314.3'. Within ...
Laura's user avatar
  • 909
2 votes
1 answer
1k views

remove sequences from fasta file matching a string in the header

I have a file with 16S sequences. some headers contain species information. For my purposes I would like to exclude a number of species from the file, therefore I would like to do a pattern matching ...
Irrussional's user avatar
1 vote
2 answers
2k views

Create BED file from list with gene symbols

Is there a way to generate a BED file of a list of gene symbols for a given genome?
justinian482's user avatar
1 vote
2 answers
224 views

Python/Biopython - Replace amino acid residue on MSA with "z" from a list of unaligned positions

I'm trying to programmatically replace a set of amino acid residues on an MSA with a "Z" from a list of unaligned positions. Any ideas on how I could do this? Input: a list of unaligned ...
Danny Morales's user avatar
0 votes
2 answers
59 views

How to obtain desired output?

I am working on a project using the following command within nano: ...
andnowmywatchbegins's user avatar