Questions tagged [fasta]

To be used for questions specific tothe sequence file format `.fasta`. Please minimise usage if the question is more generally about sequence formats.

Filter by
Sorted by
Tagged with
13
votes
8answers
7k views

How to convert fasta file to tab delimited file

I have a fasta file like >sample 1 gene 1 atgc >sample 1 gene 2 atgc >sample 2 gene 1 atgc I want to get the following output, with one break between ...
165
votes
4answers
90k views

Why does the SARS-Cov2 coronavirus genome end in aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa (33 a's)?

The SARS-Cov2 coronavirus's genome was released, and is now available on Genbank. Looking at it... ...
20
votes
10answers
5k views

What is the fastest way to calculate the number of unknown nucleotides in FASTA / FASTQ files?

I used to work with publicly available genomic references, where basic statistics are usually available and if they are not, you have to compute them only once so there is no reason to worry about ...
19
votes
7answers
10k views

How to convert FASTA to BED

I have a FASTA file: ...
37
votes
4answers
45k views

What is the difference between FASTA, FASTQ, and SAM file formats?

I'd like to learn the differences between 3 common formats such as FASTA, FASTQ and SAM. How they are different? Are there any benefits of using one over another? Based on Wikipedia pages, I can't ...
21
votes
4answers
9k views

What Ensembl genome version should I use for alignments? (e.g. toplevel.fa vs. primary_assembly.fa)

When you look at all the genome files available from Ensembl. You are presented with a bunch of options. Which one is the best to use/download? You have a combination of choices. First part options: ...
19
votes
1answer
2k views

Is it possible for coronavirus or SARS to be synthetic?

I have heard several conspiracy theories regarding the origin of the new coronavirus, 2019-nCov. For example that the virus and/or SARS were produced in a laboratory or were some variant of Middle ...
27
votes
7answers
7k views

Read length distribution from FASTA file

I have a single ~10GB FASTA file generated from an Oxford Nanopore Technologies' MinION run, with >1M reads of mean length ~8Kb. How can I quickly and efficiently calculate the distribution of read ...
3
votes
2answers
178 views

How to find/build the evolutionary history of a protein from its sequence?

I'd like to build the evolutionary history of a protein, given its sequence. Namely, given a FASTA entry how can I build an evolutionary tree? Here is the 5wxy protein as an example: ...
15
votes
9answers
2k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
11
votes
3answers
6k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
8
votes
8answers
14k views

Remove/delete sequences by ID from multifasta

I have a fasta file like this: >Id1 ATCCTT >Id2 ATTTTCCC >Id3 TTTCCCCAAAA >Id4 CCCTTTAAA I want to delete sequences that have the following IDs. <...
13
votes
6answers
327 views

Are there any databases of templates for common bioinformatic file formats?

I want some templates of different file formats that I can use to test my scripts and identify possible bugs in my code. For example, consider nucleotide FASTA, a simple but often abused format, I ...
10
votes
1answer
2k views

Changing the record id in a FASTA file using BioPython

I have the following FASTA file, original.fasta: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need ...
9
votes
5answers
3k views

How can longest isoforms (per gene) be extracted from a FASTA file?

Is there a convenient way to extract the longest isoforms from a transcriptome fasta file? I had found some scripts on biostars but none are functional and I'm having difficulty getting them to work. ...
5
votes
2answers
463 views

How can I locate duplicated regions in a sequence?

I am facing an issue when trying to align short reads against a region in human chr5. The two Sensory Motor Neuron genes, (SMN1 and SMN2) are almost 100% identical and this causes the aligner to fail ...
5
votes
1answer
848 views

Ancestry of the coronavirus 2019-nCov, WuHan city, China

In one of the answers to another question about the corona virus a link was given to this phylogenetic analysis of the virus. Can somebody assist a non-bio type here? It seems to show that the ...
2
votes
1answer
320 views

How to edit the headers of multiple fasta files from multiple folders?

My directories are organized as follows: one main directory, in which I have multiple directories that end with a number ranging from 314 to 727, followed by .3 . For example, 'mgm4761314.3'. Within ...
8
votes
4answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
5
votes
1answer
117 views

Extracting sequences from FASTA beginning with common 5' end

I am trying to figure out the best way to extract sequences from a FASTA file which begin with a common 5' region of 43 nucleotides. Preferably, I would like to to allow for "fuzziness" in this region ...
3
votes
1answer
93 views

How to use the hmmsearch on prototypic repetitive sequences Repbase Update database?

I want to use the hmmsearch proposed in Convergence of retrotransposons in oomycetes and plants by Kirill Ustyantsev, Alexandr Blinov and Georgy Smyshlyaev. After the help from terdon I managed to ...
1
vote
1answer
699 views

remove sequences from fasta file matching a string in the header

I have a file with 16S sequences. some headers contain species information. For my purposes I would like to exclude a number of species from the file, therefore I would like to do a pattern matching ...
0
votes
1answer
300 views

Remove Redundant Sequences from FASTA file in Python

I'm attempting to remove redundant sequences from a fasta file (from NCBI). When I execute this code, it returns the number of spots, not the number of sequences. (Number of spots: 408,293, Number of ...
0
votes
2answers
45 views

How to obtain desired output?

I am working on a project using the following command within nano: ...