Questions tagged [fasta]

To be used for questions specific tothe sequence file format `.fasta`. Please minimise usage if the question is more generally about sequence formats.

Filter by
Sorted by
Tagged with
165
votes
4answers
90k views

Why does the SARS-Cov2 coronavirus genome end in aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa (33 a's)?

The SARS-Cov2 coronavirus's genome was released, and is now available on Genbank. Looking at it... ...
37
votes
4answers
45k views

What is the difference between FASTA, FASTQ, and SAM file formats?

I'd like to learn the differences between 3 common formats such as FASTA, FASTQ and SAM. How they are different? Are there any benefits of using one over another? Based on Wikipedia pages, I can't ...
31
votes
4answers
9k views

Why does the FASTA sequence for coronavirus look like DNA, not RNA?

I'm looking at a genome sequence for 2019-nCoV on NCBI. The FASTA sequence looks like this: ...
28
votes
3answers
14k views

Uppercase vs lowercase letters in reference genome

I am using a reference genome for mm10 mouse downloaded from NCBI, and would like to understand in greater detail the difference between lowercase and uppercase letters, which make up roughly equal ...
27
votes
7answers
7k views

Read length distribution from FASTA file

I have a single ~10GB FASTA file generated from an Oxford Nanopore Technologies' MinION run, with >1M reads of mean length ~8Kb. How can I quickly and efficiently calculate the distribution of read ...
21
votes
4answers
9k views

What Ensembl genome version should I use for alignments? (e.g. toplevel.fa vs. primary_assembly.fa)

When you look at all the genome files available from Ensembl. You are presented with a bunch of options. Which one is the best to use/download? You have a combination of choices. First part options: ...
20
votes
10answers
5k views

What is the fastest way to calculate the number of unknown nucleotides in FASTA / FASTQ files?

I used to work with publicly available genomic references, where basic statistics are usually available and if they are not, you have to compute them only once so there is no reason to worry about ...
19
votes
7answers
9k views

How to convert FASTA to BED

I have a FASTA file: ...
19
votes
1answer
2k views

Is it possible for coronavirus or SARS to be synthetic?

I have heard several conspiracy theories regarding the origin of the new coronavirus, 2019-nCov. For example that the virus and/or SARS were produced in a laboratory or were some variant of Middle ...
15
votes
9answers
2k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
13
votes
8answers
6k views

How to convert fasta file to tab delimited file

I have a fasta file like >sample 1 gene 1 atgc >sample 1 gene 2 atgc >sample 2 gene 1 atgc I want to get the following output, with one break between ...
13
votes
6answers
326 views

Are there any databases of templates for common bioinformatic file formats?

I want some templates of different file formats that I can use to test my scripts and identify possible bugs in my code. For example, consider nucleotide FASTA, a simple but often abused format, I ...
11
votes
3answers
6k views

Converting a VCF into a FASTA given a reference with Python, R

I am interested in converting a VCF file into a FASTA file given a reference sequence with Python or R. Samtools/BCFtools (Heng Li) provides a Perl script ...
10
votes
1answer
2k views

Changing the record id in a FASTA file using BioPython

I have the following FASTA file, original.fasta: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need ...
9
votes
5answers
9k views

How to download FASTA sequences from NCBI using the terminal?

I have following accession numbers of the 10 chromosomes of Theobroma cacao genome. ...
9
votes
6answers
5k views

How do I find identical sequences in a FASTA file?

I want to create a database for a proteomics study. Therefore, the mapping from a given sequence to a protein ID has to be unique. I am wondering whether there is already a built-in function in ...
9
votes
5answers
3k views

How can longest isoforms (per gene) be extracted from a FASTA file?

Is there a convenient way to extract the longest isoforms from a transcriptome fasta file? I had found some scripts on biostars but none are functional and I'm having difficulty getting them to work. ...
8
votes
8answers
14k views

Remove/delete sequences by ID from multifasta

I have a fasta file like this: >Id1 ATCCTT >Id2 ATTTTCCC >Id3 TTTCCCCAAAA >Id4 CCCTTTAAA I want to delete sequences that have the following IDs. <...
8
votes
4answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
8
votes
2answers
3k views

Subset FASTA file by species name

I have a problem: I've managed to download a massive fasta file of 1500 sequences, but now I want to split them into separate fasta files based on the genus. EDIT The fasta file looks like this: ...
8
votes
1answer
4k views

How to extract fasta from a blastdb

How to extract the sequence used to create a blast database. This is useful when you download a blastdb from somewhere else e.g. one of the databases provided by NCBI including the 16SMicrobial ...
8
votes
3answers
140 views

How does one construct a cladogram of intraspecies relationships?

I have SNP data from several cultivars of rice which I have used to produce alignments, but I don't think that the usual models and algorithms used for generating phylogenetic trees are appropriate, ...
7
votes
4answers
2k views

Convert FASTA to FASTQ with dummy quality scores

I have a FASTA file which I would like to convert into FASTQ format as the tool I want to use my data in requires it in FASTQ format. So dummy quality scores are fine. Note: I am not using any ...
7
votes
1answer
2k views

Why is this makeblastdb command not working?

I am trying to make local databases for the ncbi-blast+ package (version 2.60). I am doing so for 4 T-cell receptor genes. 3 of the 4 (TRAV, TRAJ, TRBV) have worked fine, but I am having problems with ...
7
votes
1answer
403 views

Split FASTQ and matching BAM into matching chunks

I am running a slow downstream analysis on a large set of nanopore reads (approx 3 million), and would like to split them into smaller chunks, run the analysis in massively parallel, and then ...
6
votes
3answers
726 views

How to convert a binary matrix of gene presence or absence into a fasta sequence

I have a binary matrix of gene presence or absence which looks like: [roary output] ...
6
votes
3answers
6k views

How do I rename fasta headers?

I am trying to use the seqkit replace command to replace chromosome names in the format chr_I, chr_II, ... to I, II, .... I am ...
6
votes
2answers
718 views

How do I re-name the headers of my Fasta file?

I appologize for asking this, but I really am really bad with regex... Can someone help me transform the headers of my fasta files from this: ...
6
votes
4answers
985 views

Convert SRA to FastA

I'm trying to get the FastA files for some accessions (like NC_001416.1). I did not managed to find an FTP server or direct link to these files (I want to get it from command line with ...
6
votes
1answer
746 views

How to convert DNAbin to FASTA in R?

I am trying to convert DNAbin files to fasta format. Rationale: I want to use the fasta file to calculate non-synonymous/synonymous mutation rate. my_dnabin1 is a ...
6
votes
1answer
77 views

Detecting portions of human proteins with high degree of microbial similarity

I'm a newcomer to the world of bioinformatics, and in need of help solving a problem. My goal is to take a list of human proteins, and identify segments (13-17aa in length) with a high degree of ...
6
votes
1answer
253 views

Run gffread in multi-thread mode

Is there any possibility to run gffread in multi-thread mode? The answer seems to be 'no' from the manual (or gffread -h), as no multi-thread option is mentioned. ...
6
votes
1answer
91 views

Is there a way to assemble contigs starting from a specific sequence?

My work involves searching for marker genes/fragments in metagenomic databases (like the Sequence Read Archive). Once I find these sequences, I would like to know more about the neighboring genomic ...
5
votes
3answers
659 views

Removing duplicate FASTA sequences based on headers with Bash

I used the following command to remove duplicate FASTA sequences based on the header sequence: ...
5
votes
3answers
1k views

How to append numbers only on duplicates sequence names?

I have a reference database with contains 100s of sequences in fasta format. Some of these sequences have duplicate names like so: ...
5
votes
5answers
7k views

How to extract / convert gff3 CDS sequences to multifasta

I would like to extract all the CDS from a batch of genomes. I have found a perl script from BioStars but this does not seem to work for me. I would preferably like to have a script/ method which will ...
5
votes
2answers
289 views

Rule Extraction from nnet results

I used a script in R language that uses nnet library to predict promoter bacteria and i would like to know how to extract rules from this neural network results. As my input of the neural network i ...
5
votes
1answer
2k views

Splitting fasta file into smaller files based on header pattern

I have to split this fasta files into smaller files and write them into individual files my files ...
5
votes
3answers
999 views

finding unique headers in a fasta file using linux command line

I tried to use the following command uniq -u reference.fasta >> reference_uniq.fasta I'd like a count of the unique headers.
5
votes
1answer
237 views

Can FASTA files have nucleotide and protein sequences within them; or must they only have 1 type?

Can FASTA files have nucleotide and protein sequences within them; or must they only have 1 type? For example, a FASTA file has 2 sequences. Can the first one encode amino acids while the second one ...
5
votes
1answer
656 views

Read and write FASTA files with more information than id and sequence

I am trying to read a fasta file, manipulate is in Python (using BioPython) and then write it back. The format of my sequences is like: ...
5
votes
2answers
1k views

Fasta Sequence Identifier format?

I have been analyzing some virus DNA from the NCBI databases. The fasta sequences that I recieve from them have header lines that look like this: ...
5
votes
1answer
848 views

Ancestry of the coronavirus 2019-nCov, WuHan city, China

In one of the answers to another question about the corona virus a link was given to this phylogenetic analysis of the virus. Can somebody assist a non-bio type here? It seems to show that the ...
5
votes
3answers
2k views

How to map PDB chains to Uniprot IDs using API services

I have a lot of PDB IDs and I need to get uniprot fasta sequences of these PDB IDs special chains by API services. For example, imagine that I need to get fasta sequence of '1kf6' 'A' chain. The ...
5
votes
3answers
675 views

How can I only get the species name for fasta sequences from blast results?

I am trying to make a phylogenetic tree from sequences obtained with blast. I have files that contains hundreds of fasta protein sequences which are all named like ...
5
votes
2answers
463 views

How can I locate duplicated regions in a sequence?

I am facing an issue when trying to align short reads against a region in human chr5. The two Sensory Motor Neuron genes, (SMN1 and SMN2) are almost 100% identical and this causes the aligner to fail ...
5
votes
1answer
347 views

Can a data file in VCF format be converted into FASTA?

I'm considering purchasing the 'MyGenome' product by Veritas Genetics to analyze my genome for a project. I'd like the data to be in FASTA format, but Veritas only provides VCF data. Is it possible to ...
5
votes
1answer
147 views

How to find all variable-length seqs with an exact 5' and 3' match in a FASTA file

Context I am interested in finding all of the promotors specific to a particular sigma factor. I have identified the -35 and -10 sites from the literature, bold denotes -10, -35, binding sites: <...
5
votes
1answer
117 views

Extracting sequences from FASTA beginning with common 5' end

I am trying to figure out the best way to extract sequences from a FASTA file which begin with a common 5' region of 43 nucleotides. Preferably, I would like to to allow for "fuzziness" in this region ...
4
votes
2answers
304 views

How to align output of grep --color=always? (To QC fasta/fastq files)

Grepping out short sequences from a fasta or fastq file is a really useful way to look at sequencing data. Using the option --color=always makes this even more ...