Questions tagged [fasta]

To be used for questions specific tothe sequence file format `.fasta`. Please minimise usage if the question is more generally about sequence formats.

Filter by
Sorted by
Tagged with
1
vote
1answer
33 views

How to plot the gap distribution of contigs wrt to reference genome

I have a contigs file that I generated using Minia and then I have used Minimap2 to map these contigs again to the reference genome. Now I want to plot the gap distribution i.e. gap distance of the ...
1
vote
1answer
17 views

Transfer annotations from one genome assembly to another

I've got an annotated draft genome assembly made using short and long read strategies. I've also done optical mapping to stitch some of the contigs together, with the goal being chromsome-length ...
-1
votes
2answers
58 views

Create BED file from list with gene symbols

Is there a way to generate a BED file of a list of gene symbols for a given genome?
-1
votes
1answer
99 views

How to get a FASTA format file with the DNA sequences of all annotated genes?

I am analysing Pyrococcus Furiosus DNA sequencing data by considering data published here in NCBI. When I click on "Send to">"Gene Features">"FASTA format" I ...
1
vote
2answers
29 views

How to check if a fasta file and a GTF file fit and form a valid pair?

I'd like to know if there is a simple way to check the concordance between a GTF file and a fasta file (that I use as mapping reference) ? It may be a dumb question, but I suspect discrepancies ...
0
votes
1answer
29 views

How to know if the DNA sequence has been assembled and why is it important to know how it was assembled?

I have downloaded my FASTA format files, that have the DNA sequences of the coding region of the genes and the DNA sequence of the complete genome, from NCBI. How can I recognize if these sequences ...
0
votes
1answer
88 views

Converting Fastq files to Fasta files on Ubuntu

I am new to bioinformatics and programming. I tried to convert my fastq files to fasta file, but got this. What could be wrong? ...
0
votes
2answers
44 views

Remove from Multi-FASTA by Sequence ID

I want to remove sequence VRE32514 – it doesn’t belong and thus is the reason it lacks additional metadata. However I tried implementing this code from a similar question: ...
1
vote
2answers
88 views

Can the header line contain arbitrary text in FASTA format?

The following is a valid .fasta file content: ...
0
votes
1answer
113 views

Converting fastq to fastq.gz on windows

I downloaded some of my data in fastq format instead of fastq.gz. I want to upload my data on a server now. I was wondering if there is a way to convert my fastq files to fastq.gz on windows (I read ...
1
vote
2answers
60 views

How to identify the DNA sequence of a gene in the complete genome sequence FASTA format file?

I need to identify the sequence of a gene in the complete genome sequence . I thought it was simple, instead it is not a straightforward task ! My method was the following: I downloaded the FASTA ...
2
votes
3answers
235 views

How to extract subset of protein structure (PDB format) file based on a subsequence of that protein

I looking at a particular protein structure called 2LY4 accessible from RSCB PDB website. The corresponding fasta sequence for that structure is this: ...
2
votes
1answer
26 views

Python package or CLI tool outputting mutations of sequence with respect to reference

I'm new to bioinformatics, and I'm looking for a tool that takes two FASTA files, one containing a reference, let's call it A.fasta, the other another sequence, let'...
1
vote
2answers
73 views

Retain only part of a file name and fasta header in fasta directory

I have a MainDirectory/hundreds_of_subdirectories/thousands_of_fastas structure. For each fasta in the bottom level, I am trying to change the file name as well as ...
1
vote
0answers
54 views

How can I extract sequences from FASTA file using OTUs ID?

I have one FASTA file with sequences and headers, and one OTUs table. What I want to do is replace the current headers in the FASTA file with just the OTU IDs from the .txt file. The files look like ...
1
vote
0answers
20 views

How can I speed up FASTA ssearch output?

I'm trying to predict targets for miRNA sequences, and so far after reading some papers for other tools that do this, I've found that I should be using FASTA's ...
0
votes
1answer
76 views

Using Entrez.efetch() to retrive .fasta file from any NCBI database?

I tried to use these python codes to retrieve a .fasta file from gene database, but the output were the parameters of the report ...
1
vote
2answers
40 views

How to input the opposite strand of DNA?

I am trying to write a program that will count the repeats of a given DNA strand: I am using a Counter library, something like this code shown below ...
2
votes
2answers
72 views

Sequence allignment with suffix array?

I'm writing the code from scratch and not using libraries for the actual indexing/search since it's a project for school. Any blackbox advice is fairly useless. I'm planning on aligning some short ...
5
votes
3answers
502 views

Removing duplicate FASTA sequences based on headers with Bash

I used the following command to remove duplicate FASTA sequences based on the header sequence: ...
1
vote
0answers
31 views

Combine two alleles to genotype locus?

I have a following fasta (produced by stacks populations): ...
1
vote
1answer
46 views

Biopython BioSQL error : AttributeError: 'DBSeq' object has no attribute '_data'

Hi I am playing with Biopython and BioSQL, I manage to create an MySQL database using Managing local biological databases with the BioSQL module tutorial: and load 2909 fasta sequences in it through: <...
0
votes
1answer
50 views

Converting FASTA Sequences to SNP FASTA Format

I have two FASTA sequences. Each is from a different species' mitochondrial genome. The sequences are pasted below. ...
0
votes
2answers
123 views

Remove Redundant Sequences from FASTA file with Biopython reducing memory footprint

I need help with my Biopython code, I am kind of new to Python and Biopython so please don't be harsh on me. Everything started from here: Remove duplicated sequences in FASTA with Python I answered ...
0
votes
1answer
29 views

Extract features from fasta sequences and train the classifier

I am new to the bioinformatics field. I have positive and negative protein sequences for acetylation PTM. Now, I want to train a classifier, say SVM. What will be the next step? How can I convert ...
0
votes
1answer
67 views

Find species from FASTA files

In a school project we got the task of finding the species from two FASTA files. We got some hints of what to look for, like it is a unicellular eukaryote and that we can use blast. We don't know if ...
1
vote
3answers
240 views

Filtering Sequences (entries) by headers ID from a Fasta file database

First of all, sorry if this question has been posted previously (I could not found a solution accessing the previous Q&A). I have a fasta file as follow: ...
-3
votes
1answer
41 views

Does anyone know how I can convert DNA code into FASTA for this TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC [closed]

TTGAAACACTGGATGAATGAAAAGCCCTGCTTTGCAACCCCTCAGC this is the DNA code Sequence. I have tried converting each into the amino acid and ended up with this LKHWMNEKPCFATPQX but I was told that this isn't ...
0
votes
3answers
33 views

Genome QC + Assembly Pipeline semantics

I’m trying to create a pipeline for genome assembly. How best can I “redirect/pipe” from existing fasta files (or files in general) to other steps of the pipeline? I was thinking of going from the SRA ...
1
vote
1answer
26 views

How to get matching pattern along with ID in a single command in grep?

I have a file containing multiple fast sequneces. For a specific consensus pattern as input, I extracted all the matching patterns from target fasta sequences with ...
1
vote
1answer
70 views

How to write multi-sequence alignment data frame as a fasta format fast

I have a data frame where the row names are the species names, and each column can either be an Amino-Acid character or "-". I wish to write it in a fasta format. Simple example of the ...
2
votes
0answers
42 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
-1
votes
1answer
138 views

Biopython SeqIO check input file

Hi I am trying to learnt python3 and Biopython, I am trying to check imported fasta file before processing so far using: ...
0
votes
1answer
64 views

Metagenome simulation from a concatenated FASTA file

I am trying to simulate metagenome sequencing. So I will start with a file with a lot of concatenated genomes. From there, I would like to randomly extract 10,000 sequences of length 200bps. I got ...
1
vote
1answer
30 views

Metagenomics: Identifying most common sequences

I am working on a project and used the following command: ...
1
vote
3answers
504 views

Convert a fasta file to Newick format

My problem is (should be) pretty simple. I have a series of 10 sequences which I wish to convert into a Newick format file - what would be good software to do this? I've tried using Jalview and am ...
0
votes
2answers
44 views

FASTA and PDB: How to specify chain?

For proteins that have multiple chains (e.g., 1EMS), is there an easy way to specify which chain I want to use for blastp? I cannot imagine that I am the first person to have this problem, but so far ...
1
vote
2answers
260 views

How to replace sequence identifiers in a fasta with OTU IDs from another file?

I'm pretty new to Unix and bioinformatics and having a hard time accomplishing the following. I have one FASTA file with sequences and headers, and one OTU ID mapping file (.txt) with OTU IDs and ...
1
vote
5answers
155 views

How to remove duplicates from a fasta file using python

I am using the following command: ...
0
votes
2answers
44 views

How to obtain desired output?

I am working on a project using the following command within nano: ...
0
votes
2answers
48 views

How to fix NameError?

I am working on a project and am having issues with the following code that I have written in nano: ...
1
vote
1answer
23 views

Convert sequence in MS doc to fasta or genbank

How can I convert a sequence provided in a Microsoft doc file into a fasta or genbank format?
1
vote
1answer
44 views

Is there a simple command for outputting a tab delimited columns?

I am working on a fasta file and am writing my command in nano within command-line and executing using python, also within a command line. My objective is to get my command to provide me with a tab ...
1
vote
2answers
101 views

Extract sequences from MultiFASTA aligned file, by coordinates

I am trying to extract a specific sequence from a multifasta file, from each sequence in the aligned file. The sequences look like this, and there are 32 sequences within the multiFASTA: ...
0
votes
1answer
133 views

How to find the number of contigs produced? N50 length in base pairs? N90 length in base pairs?

I am having trouble with some underlying questions about my project. I have ran a Trinity tool to create a trinity.fasta file. To determine some underlying questions, I used the utility asm_stats to ...
1
vote
1answer
46 views

Get raw genome sequence

I'm currently working on testing some matching algorithms for strings. I would like to do some tests on raw genomic data as I expect different results from random strings given the lower entropy. How ...
0
votes
1answer
27 views

How to identify to each scaffold a read belongs to, inside a .sam file?

I have a fasta file assembly and combining it with the raw reads we produced a .bam file which I converted to .sam . The .sam information lines look like this: ...
0
votes
0answers
46 views

Python/Biopython - Replace amino acid residue on MSA with "z" from a list of unaligned positions

I'm trying to programmatically replace a set of amino acid residues on an MSA with a "Z" from a list of unaligned positions. Any ideas on how I could do this? Input: a list of unaligned ...
0
votes
0answers
37 views

Please help me with my command!

I am looking for a command to count the total number of unique proteins in a file. For instance I wrote a command to BLAST XYZ proteins as query against the DLY proteins as a database to determine the ...
1
vote
1answer
57 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...