Questions tagged [fasta]

To be used for questions specific tothe sequence file format `.fasta`. Please minimise usage if the question is more generally about sequence formats.

Filter by
Sorted by
Tagged with
12
votes
8answers
6k views

How to convert fasta file to tab delimited file

I have a fasta file like >sample 1 gene 1 atgc >sample 1 gene 2 atgc >sample 2 gene 1 atgc I want to get the following output, with one break between ...
5
votes
3answers
638 views

How can I only get the species name for fasta sequences from blast results?

I am trying to make a phylogenetic tree from sequences obtained with blast. I have files that contains hundreds of fasta protein sequences which are all named like ...
7
votes
1answer
2k views

Why is this makeblastdb command not working?

I am trying to make local databases for the ncbi-blast+ package (version 2.60). I am doing so for 4 T-cell receptor genes. 3 of the 4 (TRAV, TRAJ, TRBV) have worked fine, but I am having problems with ...
5
votes
1answer
226 views

Can FASTA files have nucleotide and protein sequences within them; or must they only have 1 type?

Can FASTA files have nucleotide and protein sequences within them; or must they only have 1 type? For example, a FASTA file has 2 sequences. Can the first one encode amino acids while the second one ...
5
votes
1answer
654 views

Read and write FASTA files with more information than id and sequence

I am trying to read a fasta file, manipulate is in Python (using BioPython) and then write it back. The format of my sequences is like: ...
4
votes
1answer
287 views

Counting a specific consecutive character with its occurrence position and length

I have a sequence file and want to count consecutive character "N", with the tandem's position of occurrence and its length. Say I have a file named mySequence.fasta...
6
votes
1answer
718 views

How to convert DNAbin to FASTA in R?

I am trying to convert DNAbin files to fasta format. Rationale: I want to use the fasta file to calculate non-synonymous/synonymous mutation rate. my_dnabin1 is a ...
5
votes
5answers
7k views

How to extract / convert gff3 CDS sequences to multifasta

I would like to extract all the CDS from a batch of genomes. I have found a perl script from BioStars but this does not seem to work for me. I would preferably like to have a script/ method which will ...
7
votes
1answer
388 views

Split FASTQ and matching BAM into matching chunks

I am running a slow downstream analysis on a large set of nanopore reads (approx 3 million), and would like to split them into smaller chunks, run the analysis in massively parallel, and then ...
8
votes
4answers
1k views

How to manipulate a reference FASTA or bam to include variants from a VCF?

I have some software which takes fastas as the input. I need to include SNVs and InDels from a VCF into the reference hg38 and then use this. The problem is, I don't know of an algorithmically sound ...
8
votes
2answers
3k views

Subset FASTA file by species name

I have a problem: I've managed to download a massive fasta file of 1500 sequences, but now I want to split them into separate fasta files based on the genus. EDIT The fasta file looks like this: ...
5
votes
2answers
1k views

Fasta Sequence Identifier format?

I have been analyzing some virus DNA from the NCBI databases. The fasta sequences that I recieve from them have header lines that look like this: ...
6
votes
3answers
719 views

How to convert a binary matrix of gene presence or absence into a fasta sequence

I have a binary matrix of gene presence or absence which looks like: [roary output] ...
2
votes
1answer
164 views

Does Prokka or gff3 change the sequence / subject ID of fasta files?

I used prokka to create a database for some fasta files but I noticed a strange difference between the prokka and fasta files. Normally the seqid for the gff3 output for prokka has seqid's that match ...
5
votes
3answers
1k views

How to append numbers only on duplicates sequence names?

I have a reference database with contains 100s of sequences in fasta format. Some of these sequences have duplicate names like so: ...
7
votes
1answer
4k views

How to extract fasta from a blastdb

How to extract the sequence used to create a blast database. This is useful when you download a blastdb from somewhere else e.g. one of the databases provided by NCBI including the 16SMicrobial ...
-2
votes
1answer
88 views

Can you tell me where these RNAi’s cleave on the Drosophila melanogaster CG2316 mRNA?

How can I work out at which sites on the Drosophila melanogaster CG2316 mRNA the RNAi`s: 12170/FBti0089992, 12168/FBtp0030589, 107343/FBtp0042163 and 41984/FBst0034349 (stock numbers/flybase ID)...
5
votes
2answers
288 views

Rule Extraction from nnet results

I used a script in R language that uses nnet library to predict promoter bacteria and i would like to know how to extract rules from this neural network results. As my input of the neural network i ...
9
votes
5answers
3k views

How can longest isoforms (per gene) be extracted from a FASTA file?

Is there a convenient way to extract the longest isoforms from a transcriptome fasta file? I had found some scripts on biostars but none are functional and I'm having difficulty getting them to work. ...
6
votes
1answer
77 views

Detecting portions of human proteins with high degree of microbial similarity

I'm a newcomer to the world of bioinformatics, and in need of help solving a problem. My goal is to take a list of human proteins, and identify segments (13-17aa in length) with a high degree of ...
20
votes
4answers
9k views

What Ensembl genome version should I use for alignments? (e.g. toplevel.fa vs. primary_assembly.fa)

When you look at all the genome files available from Ensembl. You are presented with a bunch of options. Which one is the best to use/download? You have a combination of choices. First part options: ...
13
votes
6answers
321 views

Are there any databases of templates for common bioinformatic file formats?

I want some templates of different file formats that I can use to test my scripts and identify possible bugs in my code. For example, consider nucleotide FASTA, a simple but often abused format, I ...
20
votes
10answers
4k views

What is the fastest way to calculate the number of unknown nucleotides in FASTA / FASTQ files?

I used to work with publicly available genomic references, where basic statistics are usually available and if they are not, you have to compute them only once so there is no reason to worry about ...
10
votes
1answer
2k views

Changing the record id in a FASTA file using BioPython

I have the following FASTA file, original.fasta: >foo GCTCACACATAGTTGATGCAGATGTTGAATTCACTATGAGGTGGGAGGATGTAGGGCCA I need ...
28
votes
3answers
13k views

Uppercase vs lowercase letters in reference genome

I am using a reference genome for mm10 mouse downloaded from NCBI, and would like to understand in greater detail the difference between lowercase and uppercase letters, which make up roughly equal ...
19
votes
7answers
9k views

How to convert FASTA to BED

I have a FASTA file: ...
8
votes
3answers
138 views

How does one construct a cladogram of intraspecies relationships?

I have SNP data from several cultivars of rice which I have used to produce alignments, but I don't think that the usual models and algorithms used for generating phylogenetic trees are appropriate, ...
15
votes
9answers
2k views

How to simulate NGS reads, controlling sequence coverage?

I have a FASTA file with 100+ sequences like this: >Sequence1 GTGCCTATTGCTACTAAAA ... >Sequence2 GCAATGCAAGGAAGTGATGGCGGAAATAGCGTTA ...... I also have a ...
26
votes
7answers
7k views

Read length distribution from FASTA file

I have a single ~10GB FASTA file generated from an Oxford Nanopore Technologies' MinION run, with >1M reads of mean length ~8Kb. How can I quickly and efficiently calculate the distribution of read ...
35
votes
4answers
43k views

What is the difference between FASTA, FASTQ, and SAM file formats?

I'd like to learn the differences between 3 common formats such as FASTA, FASTQ and SAM. How they are different? Are there any benefits of using one over another? Based on Wikipedia pages, I can't ...

1 2 3
4