The Stack Overflow podcast is back! Listen to an interview with our new CEO.

Questions tagged [genomics]

Genomics is an interdisciplinary field of science focusing on the structure, function, evolution, mapping, and editing of genomes.

Filter by
Sorted by
Tagged with
0
votes
2answers
38 views

Python module for fetching NCBI id for a list of species

I have a list of scientific names of species. Is there a python module that can fetch NCBI taxonomy IDs?
1
vote
0answers
16 views

How to apply RDP, Greengenes and other special taxonomies in Krona?

I used Kraken 2 to classify my 16S metagenomic data using both RDP and Greengenes database. As these are special databases the taxonomic ids assigned do not match with the NCBI taxonomic ids. I found ...
1
vote
2answers
1k views

What is the name of this type of figure?

This figure comes from this wiki page. I googled "gene location figure" and "gene location plot", none gets similar results. I also tried search by image, none of the results is close. so, what is ...
1
vote
1answer
15 views

Error Viewing file on HiGlass

I am implementing hi-glass python on Jupyter, and upon running the test data code ...
3
votes
2answers
102 views

What do the FASTQ file names mean here?

I would like to run an analysis on Nanopore data. I'm trying to download sample data from https://github.com/nanopore-wgs-consortium/chm13. I would like to run minimap on the FASTQ files, resuling in ...
0
votes
1answer
40 views

creating population AF from set of individuals in 1000 genomes population?

What's the recommended way to create population-level Allele Frequency variant entries from a set of individuals (vcfs?) in the 1000 genomes (or similar) project? For example, given the IBS ...
0
votes
1answer
40 views

what is the most complete vcf file of population allele frequencies that can be built/downloaded from public datasets?

What is the most complete vcf file of population allele frequencies that can be built/downloaded from public datasets nowadays? About 5 years or so ago, it used to be the latest release of the CSHL ...
4
votes
1answer
75 views

Generating DNA sequences with constraints

I would like some advice on potential strategies to address the following problem. I want to write a program that will generate DNA sequences that are optimized on two constraints based on an input ...
1
vote
1answer
65 views

Transcription factor targets for Human and Mouse genes

I want to get transcription factor targets for my list of genes (For Human and Mouse) I have found ENCODE Transcription Factor Targets database (The link is given below). But I am looking for some ...
1
vote
1answer
49 views

Highly variable elements?

Which type of genomic elements in the UCSC browser can be used as an example of the highly labile = highly variable = low conservation regions?
3
votes
1answer
48 views

Does UCSC definition for telomere making sense?

UCSC provides a database of telomere regions for each chromosome: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/gap.txt.gz It reported the telomere section in chr21 as: ...
2
votes
1answer
52 views

Repetition-free Longest Common Subsequence as similarity measure

I'm starting a thesis in Computer Science with topic the RFLCS (Repetition-free Longest Common Subsequence). I know very little about Bioinformatics problems and Genomics. I would like to understand ...
4
votes
1answer
60 views

Are there any Genome in a Bottle-like resources for non-humans (especially for invertebrates)?

Genome in a Bottle is an excellent resource that provides many types of DNA and RNA sequencing reads for a single individual/cell line to test genome assembly and analysis tools. For example there are ...
3
votes
2answers
206 views

Selecting 65000 SNPs where AF is close to 0.5 in all or most populations

I am evaluating the tool somalier (https://github.com/brentp/somalier) and I need to create a list of about 65,000 SNPs where the allele frequency (AF) is as close to 0.5 as possible across the most ...
2
votes
2answers
113 views

Genomics Statistics Problem

I have used a python script to identify target sequences in a DNA sequence file. There are two classes of sequence: coding and non-coding. I have identified 728 sequences of interest. 597 of these ...
5
votes
0answers
110 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
1
vote
1answer
74 views

Are there free cloud computing platforms for biology projects? [duplicate]

I want to implement the analysis found in the paper RNA-Seq of Tumor-Educated Platelets Enables Blood-Based Pan-Cancer, Multiclass, and Molecular Pathway Cancer Diagnostics The project id is 281708. ...
5
votes
1answer
102 views

How to find all variable-length seqs with an exact 5' and 3' match in a FASTA file

Context I am interested in finding all of the promotors specific to a particular sigma factor. I have identified the -35 and -10 sites from the literature, bold denotes -10, -35, binding sites: <...
7
votes
1answer
120 views

ANY (technical) reason behind submitting sequences to GenBank versus ENA Sequence

The DNA sequence sections of the three INSDC databases (i.e., DDBJ, ENA Sequence and GenBank) are synchronized periodically and strive to keep their stored data as ubiquitously accessible as possible. ...
1
vote
1answer
31 views

Genomics: Downloading genomic data from the NCBI Genbank database

I'm taking a genomics course at school, and we have a final project due in a few weeks. Now, I can write bash scripts to sort and analyze the data, etc. However, I'm not quite sure how to actually ...
1
vote
0answers
51 views

Colinearity analysis with respect to gene orientation

I was reading the manual of MCScanX and found that besides a all-vs-all protein blast file the tool takes a gtf file with four columns only: scaffold name, protein name, from, to. As the tool is not ...
0
votes
0answers
28 views

Python module bamtags

Does anyone know this python module, bamtags? I'm using a pipeline (Dovetail Genomics, HiRise) that imports it, but it seems it doesn't exist. It's impossible to install it and there is no ...
2
votes
0answers
469 views

Searching for start and stop codons for protein sequencing of contigs

I need to convert contigs into their respective protein sequences given a reference genome (i.e. I need to take a substring, whose position is already known on the string, and I need to locate the ...
3
votes
1answer
57 views

How to query the Human Microbiome Project (HMP) to find all subjects with both 16s and WGS workups?

I am looking for a query to run on the HMP database that will return all subjects who have had BOTH 16s and whole genomes sequence (WGS) workups. I am currently using this query... ...
2
votes
2answers
52 views

Genomic coordinates of predicted binding pocket

I would like to know the genomic coordinates of a proteins ligand-binding pocket. For example, on this PDB page you can see that there is xray crystallography data for how CYP2C9 interacts with two ...
3
votes
1answer
145 views

Path to career in bioinformatics?

I've been completing various courses on bioinformatics through edX and Coursera, and I've made a strong footing in the material. I'm not sure what to pursue next in bioinformatics that would bring ...
1
vote
0answers
116 views

Meaning of category in MutSigCV

I am trying to understand the working of MutSigCV. But I am not sure about some terms used in MAF file format which is category. According to MutSigCV, every mutation can be divided into the following ...
6
votes
1answer
105 views

Meaning of the FORMAT fields of the VCF file coming from GIAB project

After reading the GIAB paper in https://www.biorxiv.org/content/early/2018/05/25/281006 and its Figure 1, I am still having trouble understanding the data inside the GIAB VCF file for HG001 (...
1
vote
1answer
96 views

How to download SNP data from specific regions, population and positions?

I am totally new in Bioinformatics and I would like to apply my knowledge in feature selection on the tag SNP problems. To do that, I've read a lot of papers and books in order to understand the main ...
3
votes
1answer
73 views

Difference between copy number neutral reads and active reads

In this paper, the authors talk about copy number neutral reads (as reads that equally represent parental chromosomes) and active reads (as reads from only one parent chromosome): We reasoned that ...
0
votes
0answers
52 views

“Cleaning up” a gene heatmap in R

I'm using the ComplexHeatMap function from Bioconductor to display a heatmap showing the presence/absence of hundreds of loci of interest, but I need to clean it up ...
0
votes
0answers
47 views

Complete Genomics Junction file for SV Detection

At present, I have vcf file for each patient generated from tumor data. I am using virtual normal correction method for somatic mutation detection because I don't have normal data. For SNP or small ...
1
vote
1answer
177 views

How can I improve ESS values for ucldMean in beast?

Using starBeast I ran a 50 locus tree, with 34 individuals, using evolutionary models indicated by AICc in jModel test. I ran this tree with a MCMC chain length of 500 million, storing every 10,000 ...
12
votes
1answer
153 views

Is it possible to use SNP heterozygosity as a proxy for Indel heterozygosity?

I have estimated genome-wide heterozygosity levels using maximum likelihood and classical substitution model implemented in package atlas. These estimates are way more robust than classical SNP ...
-1
votes
1answer
167 views

Command not found error on HISAT2

I have been attempting to map reads to a reference genome using HISAT2 using the Pertea, et al 2016 Nature Protocols paper. I am able to successfully generate an index (using the hisat2-build command),...
0
votes
0answers
121 views

How can I calculate and compare intra-cluster correlation for each GO term and pathway?

How can I calculate and compare intra-cluster correlation for each GO term and pathway? I want for all the genes, which belong to the same GO-term, calculate a similarity score. Each GO term can be ...
3
votes
1answer
50 views

predict the foldability of single-stranded DNA molecules

I have a list of regions of the human genome and I want to predict if single-stranded molecules in a buffer would tend to fold and create pin structures by sequence self-complementarity. What's the ...
7
votes
1answer
270 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
1
vote
2answers
2k views

What are the differences between GWAS and QTL mapping? [closed]

What are the differences between the two methods? What advantages does one have over the other, and what are their limitations relative to one another?
2
votes
1answer
112 views

What does “motif 2 bp or longer” mean?

I'm reading a preprint on a new somatic variant discovery tool, and the first sentence of the Discussion section has me confused. Across the four datasets analyzed in this study, we discovered that ...
5
votes
3answers
724 views

Somatic tumor only variant calling?

I'm evaluating possibilites for somatic tumor variant calling without paired-normal samples. I'm aware of the consequences without a normal sample. All the popular variant calling tools such as ...
3
votes
1answer
72 views

Installing Sibelia for Ragout on Mac OSX

I am trying to use Ragout: https://github.com/fenderglass/Ragout to fill the gaps in my de novo genome assembly. You can access the article freely here: https://www.ncbi.nlm.nih.gov/pubmed/24931998 ...
4
votes
1answer
330 views

Using BLAT command line tool to blat split sequences

I have the nucleotide sequence: AATTGAGGCACATTTTTTTTTAGACAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATCATAGCTCACTGCAGCCTCGACCTCCTGGGCTCAACAAAGCACACAGTGGGCGGATCCCCACCAG When I blat this on UCSC Genome ...
5
votes
3answers
234 views

How to adapt the fgseaL function to perform rapidGSEA computation of gene ranks across 9 different phenotype labels?

I wish to adapt the r language function fgseaL, https://github.com/ctlab/fgsea , to perform rapidGSEA, https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1244-x , computation of ...
4
votes
5answers
2k views

using python to write bioinformatics pipelines tutorial

I was wondering if there is a tutorial or a small code snippet to understand how to write bioinformatics pipeline using python, for example use a aligner (say hisat) get the output and process it ...
4
votes
3answers
515 views

Range overlap python error with genomic regions

I have two files s3.txt : 1 10 20 1 5 20 2 20 30 2 25 30 1 10 50 2 20 60 1 14 17 s4.txt: 1 10 20 2 20 30 I am trying to match col0 ...
16
votes
1answer
323 views

The state, limitations and comparisons of large variant stores

Background: We're increasingly needing some way of storing lots of variant data associated with lots of subjects: think clinical trials and hospital patients, looking for disease-causing or relevant ...
6
votes
1answer
326 views

How to filter out cross alignments from a BED file?

I have a BAM file: ...