Questions tagged [genomics]

Genomics is an interdisciplinary field of science focusing on the structure, function, evolution, mapping, and editing of genomes.

Filter by
Sorted by
Tagged with
17
votes
1answer
418 views

The state, limitations and comparisons of large variant stores

Background: We're increasingly needing some way of storing lots of variant data associated with lots of subjects: think clinical trials and hospital patients, looking for disease-causing or relevant ...
12
votes
1answer
172 views

Is it possible to use SNP heterozygosity as a proxy for Indel heterozygosity?

I have estimated genome-wide heterozygosity levels using maximum likelihood and classical substitution model implemented in package atlas. These estimates are way more robust than classical SNP ...
7
votes
1answer
598 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
7
votes
1answer
262 views

ANY (technical) reason behind submitting sequences to GenBank versus ENA Sequence

The DNA sequence sections of the three INSDC databases (i.e., DDBJ, ENA Sequence and GenBank) are synchronized periodically and strive to keep their stored data as ubiquitously accessible as possible. ...
6
votes
1answer
446 views

How to filter out cross alignments from a BED file?

I have a BAM file: ...
6
votes
2answers
263 views

Meaning of the FORMAT fields of the VCF file coming from GIAB project

After reading the GIAB paper in https://www.biorxiv.org/content/early/2018/05/25/281006 and its Figure 1, I am still having trouble understanding the data inside the GIAB VCF file for HG001 (...
6
votes
1answer
430 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
5
votes
3answers
1k views

Somatic tumor only variant calling?

I'm evaluating possibilites for somatic tumor variant calling without paired-normal samples. I'm aware of the consequences without a normal sample. All the popular variant calling tools such as ...
5
votes
4answers
1k views

Range overlap python error with genomic regions

I have two files s3.txt : 1 10 20 1 5 20 2 20 30 2 25 30 1 10 50 2 20 60 1 14 17 s4.txt: 1 10 20 2 20 30 I am trying to match col0 ...
5
votes
3answers
252 views

How to adapt the fgseaL function to perform rapidGSEA computation of gene ranks across 9 different phenotype labels?

I wish to adapt the r language function fgseaL, https://github.com/ctlab/fgsea , to perform rapidGSEA, https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1244-x , computation of ...
5
votes
1answer
146 views

How to find all variable-length seqs with an exact 5' and 3' match in a FASTA file

Context I am interested in finding all of the promotors specific to a particular sigma factor. I have identified the -35 and -10 sites from the literature, bold denotes -10, -35, binding sites: <...
4
votes
5answers
3k views

using python to write bioinformatics pipelines tutorial

I was wondering if there is a tutorial or a small code snippet to understand how to write bioinformatics pipeline using python, for example use a aligner (say hisat) get the output and process it ...
4
votes
3answers
819 views

What do the FASTQ file names mean here?

I would like to run an analysis on Nanopore data. I'm trying to download sample data from https://github.com/nanopore-wgs-consortium/chm13. I would like to run minimap2 on the FASTQ files, resulting ...
4
votes
1answer
534 views

Using BLAT command line tool to blat split sequences

I have the nucleotide sequence: AATTGAGGCACATTTTTTTTTAGACAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATCATAGCTCACTGCAGCCTCGACCTCCTGGGCTCAACAAAGCACACAGTGGGCGGATCCCCACCAG When I blat this on UCSC Genome ...
4
votes
1answer
90 views

Generating DNA sequences with constraints

I would like some advice on potential strategies to address the following problem. I want to write a program that will generate DNA sequences that are optimized on two constraints based on an input ...
4
votes
1answer
84 views

Does UCSC definition for telomere making sense?

UCSC provides a database of telomere regions for each chromosome: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/gap.txt.gz It reported the telomere section in chr21 as: ...
4
votes
1answer
64 views

Are there any Genome in a Bottle-like resources for non-humans (especially for invertebrates)?

Genome in a Bottle is an excellent resource that provides many types of DNA and RNA sequencing reads for a single individual/cell line to test genome assembly and analysis tools. For example there are ...
3
votes
2answers
256 views

Selecting 65000 SNPs where AF is close to 0.5 in all or most populations

I am evaluating the tool somalier (https://github.com/brentp/somalier) and I need to create a list of about 65,000 SNPs where the allele frequency (AF) is as close to 0.5 as possible across the most ...
3
votes
1answer
222 views

What are the coordinates of the extended major histocompatibility complex (xMHC) in GRCh38?

Is there an accepted boundary of the extended major histocompatibility complex (xMHC) in human? Specifically, I am interested in the boundary coordinates for Genome Reference Consortium Human Build 38 ...
3
votes
1answer
98 views

Installing Sibelia for Ragout on Mac OSX

I am trying to use Ragout: https://github.com/fenderglass/Ragout to fill the gaps in my de novo genome assembly. You can access the article freely here: https://www.ncbi.nlm.nih.gov/pubmed/24931998 ...
3
votes
1answer
159 views

Path to career in bioinformatics?

I've been completing various courses on bioinformatics through edX and Coursera, and I've made a strong footing in the material. I'm not sure what to pursue next in bioinformatics that would bring ...
3
votes
1answer
1k views

Searching for start and stop codons for protein sequencing of contigs

I need to convert contigs into their respective protein sequences given a reference genome (i.e. I need to take a substring, whose position is already known on the string, and I need to locate the ...
3
votes
1answer
93 views

Difference between copy number neutral reads and active reads

In this paper, the authors talk about copy number neutral reads (as reads that equally represent parental chromosomes) and active reads (as reads from only one parent chromosome): We reasoned that ...
3
votes
1answer
63 views

predict the foldability of single-stranded DNA molecules

I have a list of regions of the human genome and I want to predict if single-stranded molecules in a buffer would tend to fold and create pin structures by sequence self-complementarity. What's the ...
3
votes
1answer
67 views

How to query the Human Microbiome Project (HMP) to find all subjects with both 16s and WGS workups?

I am looking for a query to run on the HMP database that will return all subjects who have had BOTH 16s and whole genomes sequence (WGS) workups. I am currently using this query... ...
2
votes
2answers
122 views

Genomics Statistics Problem

I have used a python script to identify target sequences in a DNA sequence file. There are two classes of sequence: coding and non-coding. I have identified 728 sequences of interest. 597 of these ...
2
votes
2answers
60 views

Genomic coordinates of predicted binding pocket

I would like to know the genomic coordinates of a proteins ligand-binding pocket. For example, on this PDB page you can see that there is xray crystallography data for how CYP2C9 interacts with two ...
2
votes
1answer
176 views

What does "motif 2 bp or longer" mean?

I'm reading a preprint on a new somatic variant discovery tool, and the first sentence of the Discussion section has me confused. Across the four datasets analyzed in this study, we discovered that ...
2
votes
1answer
74 views

Are there genomics databases for neurological and psychiatric disorders?

Are there databases that relate genetic disorders with neurological disorders? I am thinking of something like COSMICS for cancer? AFAIK cancer usually develops due to a combination of 5-10 ...
2
votes
1answer
68 views

How to download data from SRA in Linux systems via the command line?

My workflow for downloading data from SRA has been the following: Access SRA Run Selector. Enter the accession number for the project of interest. Download "Accession List" for the "...
2
votes
1answer
84 views

COVID-19 GWAS: what is a cross-replicating association?

In a genomic study of patients infected with SARS-CoV-2, the authors detected cross-replicating associations with rs11385942 at locus 3p21.31 , the association signal spanned the genes SLC6A20, ...
2
votes
1answer
63 views

How to extract hypervariable region of mitochondrial dna from its fasta file?

Recently I've done some analysis on human mitochondrial DNA and now I want to run the same analysis on only hypervariable regions of mitochondrial DNA to see whether the changes that I have observed ...
2
votes
2answers
7k views

What are the differences between GWAS and QTL mapping? [closed]

What are the differences between the two methods? What advantages does one have over the other, and what are their limitations relative to one another?
2
votes
1answer
56 views

Repetition-free Longest Common Subsequence as similarity measure

I'm starting a thesis in Computer Science with topic the RFLCS (Repetition-free Longest Common Subsequence). I know very little about Bioinformatics problems and Genomics. I would like to understand ...
2
votes
1answer
425 views

How can I improve ESS values for ucldMean in beast?

Using starBeast I ran a 50 locus tree, with 34 individuals, using evolutionary models indicated by AICc in jModel test. I ran this tree with a MCMC chain length of 500 million, storing every 10,000 ...
2
votes
0answers
16 views

When to use Ariba vs Roary or other genomics tools to call drug-resistance variants?

I have a large dataset of assemblies of bacterial S. aureus genomes (~1000, same species). I am looking at different tools to estimate the presence of drug-resistance factors such as blaZ or ampC. ...
2
votes
0answers
243 views

Kraken2 > OTU format > Phyloseq

A collaborator has passed me over Kraken2 outputs *.report and *.kraken, from a metatranscriptomic sequencing experiment conducted on the minION. I would like to use this data in phyloseq, however, I ...
2
votes
0answers
28 views

What Cellbase resources are 0-indexed, and which are 1-indexed?

The UCSC Genome Browser Team is clear about that the genome browser GUI indexing which is 1-based, closed interval. Genomic sequence retrieval via the UCSC REST API is 1-based, closed interval. All ...
1
vote
2answers
1k views

What is the name of this type of figure?

This figure comes from this wiki page. I googled "gene location figure" and "gene location plot", none gets similar results. I also tried search by image, none of the results is close. so, what is ...
1
vote
2answers
54 views

Finding SNP/Indel Markers of Interspecific Variation

This is a revised version of my original question, edited to include the portions already answered by @Maximilian Press. Goal: Find SNP and indel alleles which are fixed between but lack polymorphism ...
1
vote
2answers
117 views

Transcription factor targets for Human and Mouse genes

I want to get transcription factor targets for my list of genes (For Human and Mouse) I have found ENCODE Transcription Factor Targets database (The link is given below). But I am looking for some ...
1
vote
1answer
63 views

Genomics: Downloading genomic data from the NCBI Genbank database

I'm taking a genomics course at school, and we have a final project due in a few weeks. Now, I can write bash scripts to sort and analyze the data, etc. However, I'm not quite sure how to actually ...
1
vote
1answer
63 views

How to compact variant data to their genes without bias?

I have a dataset of genes I am trying to collect data on from public databases, to use as features in machine learning. I am trying to take some features from UCSC genome browser (e.g. number of CpG ...
1
vote
1answer
43 views

How to compute Shanon entropy

I want to analyze some viral sequences. I want to use shanon entropy as a measure to analyze the sequences. However I do not understand the concept of shannon entropy. Would anyone explain please how ...
1
vote
3answers
158 views

Python module for fetching NCBI id for a list of species

I have a list of scientific names of species. Is there a python module that can fetch NCBI taxonomy IDs?
1
vote
1answer
298 views

How to download SNP data from specific regions, population and positions?

I am totally new in Bioinformatics and I would like to apply my knowledge in feature selection on the tag SNP problems. To do that, I've read a lot of papers and books in order to understand the main ...
1
vote
1answer
17 views

Transfer annotations from one genome assembly to another

I've got an annotated draft genome assembly made using short and long read strategies. I've also done optical mapping to stitch some of the contigs together, with the goal being chromsome-length ...
1
vote
1answer
57 views

How to identify unknow bacterium species from whole genome genetic sequence

I am a Biochemist that is unfamiliar with bioinformatic tools and new to academia as a whole. I am currently using ILLUMINA PE data, which I trimmed (Trimmomatic), corrected (Rcorrector) and assembled ...
1
vote
1answer
39 views

What does these terms mean?

I am working on cancer genomics failed to follow some terms even by googling What is the difference of focal genome amplifications versus convergent amplification of given region of genome for ...