Skip to main content

Questions tagged [genomics]

Genomics is an interdisciplinary field of science focusing on the structure, function, evolution, mapping, and editing of genomes.

Filter by
Sorted by
Tagged with
20 votes
1 answer
471 views

The state, limitations and comparisons of large variant stores

Background: We're increasingly needing some way of storing lots of variant data associated with lots of subjects: think clinical trials and hospital patients, looking for disease-causing or relevant ...
agapow's user avatar
  • 788
13 votes
1 answer
188 views

Is it possible to use SNP heterozygosity as a proxy for Indel heterozygosity?

I have estimated genome-wide heterozygosity levels using maximum likelihood and classical substitution model implemented in package atlas. These estimates are way more robust than classical SNP ...
Kamil S Jaron's user avatar
7 votes
1 answer
845 views

ethnicity check either from bam or vcf files

What tool could I use to check the ethnicity of a human bam or vcf file? I would like to use the results as a QC check to know whether a given sample or set of samples match the ethnicity information ...
719016's user avatar
  • 2,344
7 votes
1 answer
446 views

ANY (technical) reason behind submitting sequences to GenBank versus ENA Sequence

The DNA sequence sections of the three INSDC databases (i.e., DDBJ, ENA Sequence and GenBank) are synchronized periodically and strive to keep their stored data as ubiquitously accessible as possible. ...
Michael Gruenstaeudl's user avatar
6 votes
3 answers
2k views

Somatic tumor only variant calling?

I'm evaluating possibilites for somatic tumor variant calling without paired-normal samples. I'm aware of the consequences without a normal sample. All the popular variant calling tools such as ...
SmallChess's user avatar
  • 2,729
6 votes
1 answer
497 views

How to filter out cross alignments from a BED file?

I have a BAM file: ...
SmallChess's user avatar
  • 2,729
6 votes
2 answers
411 views

Meaning of the FORMAT fields of the VCF file coming from GIAB project

After reading the GIAB paper in https://www.biorxiv.org/content/early/2018/05/25/281006 and its Figure 1, I am still having trouble understanding the data inside the GIAB VCF file for HG001 (...
Javier's user avatar
  • 161
6 votes
1 answer
804 views

Proof of Breakpoint Reversal Sorting Approximation Algorithm

I'm kind of new to bioinformatics and trying to self-study. I'm reading a bioinformatics book: An Introduction to Bioinformatics Algorithms and ran into some problems about understanding the proof of ...
Hang Le's user avatar
  • 61
5 votes
4 answers
2k views

Range overlap python error with genomic regions

I have two files s3.txt : 1 10 20 1 5 20 2 20 30 2 25 30 1 10 50 2 20 60 1 14 17 s4.txt: 1 10 20 2 20 30 I am trying to match col0 ...
novicebioinforesearcher's user avatar
5 votes
3 answers
288 views

How to adapt the fgseaL function to perform rapidGSEA computation of gene ranks across 9 different phenotype labels?

I wish to adapt the r language function fgseaL, https://github.com/ctlab/fgsea , to perform rapidGSEA, https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1244-x , computation of ...
Frank's user avatar
  • 191
5 votes
2 answers
77 views

How do I summarise VCF files?

I have got a number of VCF files that all contain data on one particular variant, with every VCF being created from an individual sample. So there is one entry per file (headers omitted): ...
Nereus's user avatar
  • 229
5 votes
1 answer
182 views

How to find all variable-length seqs with an exact 5' and 3' match in a FASTA file

Context I am interested in finding all of the promotors specific to a particular sigma factor. I have identified the -35 and -10 sites from the literature, bold denotes -10, -35, binding sites: <...
syn_bio_delta's user avatar
4 votes
5 answers
4k views

using python to write bioinformatics pipelines tutorial

I was wondering if there is a tutorial or a small code snippet to understand how to write bioinformatics pipeline using python, for example use a aligner (say hisat) get the output and process it ...
novicebioinforesearcher's user avatar
4 votes
3 answers
3k views

What do the FASTQ file names mean here?

I would like to run an analysis on Nanopore data. I'm trying to download sample data from https://github.com/nanopore-wgs-consortium/chm13. I would like to run minimap2 on the FASTQ files, resulting ...
SmallChess's user avatar
  • 2,729
4 votes
1 answer
679 views

Using BLAT command line tool to blat split sequences

I have the nucleotide sequence: AATTGAGGCACATTTTTTTTTAGACAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATCATAGCTCACTGCAGCCTCGACCTCCTGGGCTCAACAAAGCACACAGTGGGCGGATCCCCACCAG When I blat this on UCSC Genome ...
Set's user avatar
  • 241
4 votes
1 answer
123 views

Generating DNA sequences with constraints

I would like some advice on potential strategies to address the following problem. I want to write a program that will generate DNA sequences that are optimized on two constraints based on an input ...
cmdoret's user avatar
  • 615
4 votes
1 answer
38 views

How to extract all variant alleles that do not match "./." from the GT column of a vcf file?

For the two vcf files linked below, I cannot find any variants in the GT column other than "./.". Is it possible to confirm if the GT column of vcf files have been annotated (i.e variants ...
CoderQ's user avatar
  • 43
4 votes
1 answer
94 views

Does UCSC definition for telomere making sense?

UCSC provides a database of telomere regions for each chromosome: ftp://hgdownload.cse.ucsc.edu/goldenPath/hg19/database/gap.txt.gz It reported the telomere section in chr21 as: ...
SmallChess's user avatar
  • 2,729
4 votes
1 answer
72 views

Are there any Genome in a Bottle-like resources for non-humans (especially for invertebrates)?

Genome in a Bottle is an excellent resource that provides many types of DNA and RNA sequencing reads for a single individual/cell line to test genome assembly and analysis tools. For example there are ...
conchoecia's user avatar
  • 3,181
4 votes
1 answer
66 views

Identifying somatic mutations in cell lines

I would like to identify the somatic mutations present in a cell line and characterise the genes that are potentially affected by those mutations. For example, are there oncogenes mutated in a ...
Macintosh's user avatar
  • 160
3 votes
2 answers
276 views

Selecting 65000 SNPs where AF is close to 0.5 in all or most populations

I am evaluating the tool somalier (https://github.com/brentp/somalier) and I need to create a list of about 65,000 SNPs where the allele frequency (AF) is as close to 0.5 as possible across the most ...
719016's user avatar
  • 2,344
3 votes
1 answer
2k views

What are the coordinates of the extended major histocompatibility complex (xMHC) in GRCh38?

Is there an accepted boundary of the extended major histocompatibility complex (xMHC) in human? Specifically, I am interested in the boundary coordinates for Genome Reference Consortium Human Build 38 ...
Daniel Himmelstein's user avatar
3 votes
1 answer
204 views

What does "motif 2 bp or longer" mean?

I'm reading a preprint on a new somatic variant discovery tool, and the first sentence of the Discussion section has me confused. Across the four datasets analyzed in this study, we discovered that ...
Daniel Standage's user avatar
3 votes
1 answer
135 views

Installing Sibelia for Ragout on Mac OSX

I am trying to use Ragout: https://github.com/fenderglass/Ragout to fill the gaps in my de novo genome assembly. You can access the article freely here: https://www.ncbi.nlm.nih.gov/pubmed/24931998 ...
Biomagician's user avatar
  • 2,469
3 votes
1 answer
102 views

How to calculate distance between two regions from bed like dataframe in R?

I'm wondering how can I calculate the distance between two regions from the bed (chr, start, ...
Deb's user avatar
  • 319
3 votes
1 answer
96 views

What does the absence of a variant in a VCF file mean?

I have a individual.snp.vcf.gz file of an individual genome and the referencegenome.snp.vcf.gz file of the reference genome. ...
williantafsilva's user avatar
3 votes
1 answer
177 views

What is it about gene names starting with "LOC"?

I was struggling to use AnnotationDbi to change my ensemble ID to gene name, for datasets of three different species (human, canine, mouse). Among gene names for all three species there are genes with ...
ToTheMoon's user avatar
3 votes
1 answer
123 views

How to perform liftover from 38 to 37 in R?

I have some gwas summary statistics in GRCh38 that I want to lift to GRCh37. I am trying to liftover in R using this code: ...
DN1's user avatar
  • 85
3 votes
1 answer
191 views

Path to career in bioinformatics?

I've been completing various courses on bioinformatics through edX and Coursera, and I've made a strong footing in the material. I'm not sure what to pursue next in bioinformatics that would bring ...
Rock910's user avatar
  • 41
3 votes
1 answer
64 views

tensorQTL interaction issue

I hope that the question has its place on this board. I am trying to run the mapping of cis eQTL using an interaction term with tensorQTL. I am running into the following index error when running the ...
Solal's user avatar
  • 51
3 votes
1 answer
36 views

How to access yeast-cyc in a programmatic way to extract the GO terms?

I am a newbie in Bioinformatics, I want to extract the GO terms from yeast-cyc, which is items in the Go terms tab of this page https://yeast.biocyc.org/gene?orgid=YEAST&id=G3O-29622#tab=GO , not ...
Mountain's user avatar
  • 133
3 votes
1 answer
10k views

What are the differences between GWAS and QTL mapping? [closed]

What are the differences between the two methods? What advantages does one have over the other, and what are their limitations relative to one another?
jhurst5's user avatar
  • 69
3 votes
1 answer
2k views

Searching for start and stop codons for protein sequencing of contigs

I need to convert contigs into their respective protein sequences given a reference genome (i.e. I need to take a substring, whose position is already known on the string, and I need to locate the ...
Thomas Ribeiro's user avatar
3 votes
1 answer
110 views

Difference between copy number neutral reads and active reads

In this paper, the authors talk about copy number neutral reads (as reads that equally represent parental chromosomes) and active reads (as reads from only one parent chromosome): We reasoned that ...
wrong_path's user avatar
3 votes
1 answer
75 views

predict the foldability of single-stranded DNA molecules

I have a list of regions of the human genome and I want to predict if single-stranded molecules in a buffer would tend to fold and create pin structures by sequence self-complementarity. What's the ...
719016's user avatar
  • 2,344
3 votes
1 answer
74 views

How to query the Human Microbiome Project (HMP) to find all subjects with both 16s and WGS workups?

I am looking for a query to run on the HMP database that will return all subjects who have had BOTH 16s and whole genomes sequence (WGS) workups. I am currently using this query... ...
ljs's user avatar
  • 265
2 votes
2 answers
249 views

BWA-mem and sambamba read group line error

this question has been asked [and answered] on Stack Overflow This is a two-part question: help interpreting an error; help with coding. I'm trying to run bwa-mem ...
Gustavo de Miranda's user avatar
2 votes
2 answers
129 views

Genomics Statistics Problem

I have used a python script to identify target sequences in a DNA sequence file. There are two classes of sequence: coding and non-coding. I have identified 728 sequences of interest. 597 of these ...
syn_bio_delta's user avatar
2 votes
2 answers
71 views

Genomic coordinates of predicted binding pocket

I would like to know the genomic coordinates of a proteins ligand-binding pocket. For example, on this PDB page you can see that there is xray crystallography data for how CYP2C9 interacts with two ...
Greg's user avatar
  • 831
2 votes
1 answer
40 views

How to measure mean of a column for every 10000 rows condition on other column?

I have a large bed-like dataframe with over 30 million rows. What is the best way to calculate the mean value of fourth column ...
Deb's user avatar
  • 319
2 votes
1 answer
93 views

Creating custom VCF file

I'm stuck on what seems to be a banal problem, but I can't work out where the issue is. I need to create some customised VCF files that specify particular variants of interest. This is a custom VCF I ...
Nereus's user avatar
  • 229
2 votes
1 answer
64 views

At what point is a gene different between species that we call it a different gene?

I am new to genetics and I know humans share many genes with mice for instance but that there are slight differences in conserved nucleotide sequences. Is there a community consensus around at what ...
Angus Campbell's user avatar
2 votes
1 answer
88 views

Are there genomics databases for neurological and psychiatric disorders?

Are there databases that relate genetic disorders with neurological disorders? I am thinking of something like COSMICS for cancer? AFAIK cancer usually develops due to a combination of 5-10 ...
0x90's user avatar
  • 1,447
2 votes
1 answer
103 views

How are the "effect_allele" and "other_allele" bases chosen in a PGS file from the PGS Catalog?

How are the "effect_allele" and "other_allele" bases chosen in a PGS file from the PGS Catalog? For example, for PGS002723 (https://www.pgscatalog.org/score/PGS002723/), if I set ...
Cristian Riccio's user avatar
2 votes
1 answer
66 views

Inconsistent replicate numbers in RNA-seq

I have 3 groups for the RNA-seq analysis (Control, treatment A and treatment B). There are 2 replicates for control and treatment A and 3 replicates for treatment B (lost 2 replicates due to a mistake ...
Wang Ming's user avatar
  • 101
2 votes
1 answer
38 views

Using very closely related strains to increase coverage for short read, de novo assembly

Do you think it's possible to combine short read Illumina libraries (WGS) from multiple closely related eukaryotic microbial strains (e.g. libraries from a re-sequencing study, >99% ITS1 sequence) ...
bishopia's user avatar
2 votes
1 answer
1k views

how to retain reads with low mapping quality (MAPQ) scores when using samtools view -q

I have been using the -q option of samtools view to filter out reads whose mapping quality (MAPQ) scores are below a given ...
Patrick Bastedo's user avatar
2 votes
1 answer
421 views

Transfer annotations from one genome assembly to another

I've got an annotated draft genome assembly made using short and long read strategies. I've also done optical mapping to stitch some of the contigs together, with the goal being chromsome-length ...
hac's user avatar
  • 21
2 votes
1 answer
3k views

How to download data from SRA in Linux systems via the command line?

My workflow for downloading data from SRA has been the following: Access SRA Run Selector. Enter the accession number for the project of interest. Download "Accession List" for the "...
pietro_molina's user avatar
2 votes
1 answer
139 views

COVID-19 GWAS: what is a cross-replicating association?

In a genomic study of patients infected with SARS-CoV-2, the authors detected cross-replicating associations with rs11385942 at locus 3p21.31 , the association signal spanned the genes SLC6A20, ...
Dare to ask-I dnt mind punishm's user avatar