Questions tagged [grep]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1
vote
1answer
19 views

How to get matching pattern along with ID in a single command in grep?

I have a file containing multiple fast sequneces. For a specific consensus pattern as input, I extracted all the matching patterns from target fasta sequences with ...
1
vote
2answers
50 views

FASTQ file reads extraction paired ends

I have paired end reads and want to extract only those which have this sequence within them: TGTATGTAAACTTCCGACTTCAACTGTA I tried using ...
1
vote
2answers
57 views

How to replace sequence identifiers in a fasta with OTU IDs from another file?

I'm pretty new to Unix and bioinformatics and having a hard time accomplishing the following. I have one FASTA file with sequences and headers, and one OTU ID mapping file (.txt) with OTU IDs and ...
1
vote
0answers
29 views

How do I Read a Sam File into a String Using ifstream in C++?

I am trying to read a .sam file into a single string in C++. My end goal is to read this string into a vector, where tabs indicate separations between elements of the vector. After making a vector ...
1
vote
2answers
85 views

Extract sequences from partial Header

I have a library I would like to split them based on their headers. Some are related to RNA and DNA. The header contains much information, but the most important the presence of DNA or RNA/LTR.., ...