Questions tagged [human-genome]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
4
votes
1answer
59 views

Authoritative source on human cytogenetic regions?

I am looking for a database that would keep track of human cytogenetic regions and genomic coordinates per genome assembly. I had expected the Genome Reference Consortium to have it, or Ensembl, or ...
1
vote
0answers
70 views

Reproducing population structure from 1000 Genomes Data

I recently tried to reproduce population structure with 1000 Genomes Project data (Phase 3, 2504 people). According to supplementary material, To reduce the dataset, we used VCFtools to only keep ...
6
votes
1answer
115 views

Meaning of the FORMAT fields of the VCF file coming from GIAB project

After reading the GIAB paper in https://www.biorxiv.org/content/early/2018/05/25/281006 and its Figure 1, I am still having trouble understanding the data inside the GIAB VCF file for HG001 (...
4
votes
3answers
80 views

Public access to genomics databases

I'm a statistician, and am interested in applying the theory of algebraic Markov models to genomics. Here's one paper I'm interested in: Large-scale genome-wide association analysis of bipolar ...
6
votes
1answer
87 views

Does the DNA or RNA of some ethnic groups map better than others' to the human reference genome sequence?

I believe that the human genome reference took DNA samples from different people and that some natural variation is included in extra contigs. However, the human reference genome comes from a ...
8
votes
3answers
747 views

Least present k-mers in the human genome

What are the least present k-mers in the human genome at different sizes? Starting with k=4 and going up in size until k=10, what are the k-mers least seen (or not at all) in the human genome? I am ...
2
votes
1answer
223 views

Dealing with indels when converting a position to chromStart and chromEnd for a bed file

Starting with a chromosome # and position, I am trying to get chromStart and chromEnd values for a .bed file, but I am not sure how to calculate chromEnd when I have a variant that is an insertion or ...
1
vote
1answer
52 views

TCGA bam file duplicates (aligned reads) and related last part of TCGA barcode

I am running an analysis on TCGA bam files (GCRh37/hg19) of whole exome sequencing data. I usually find one bam file for each sample. However, at least one sample has two bam files, in which the last ...
5
votes
1answer
1k views

hg38 GTF file with RefSeq annotations

I'm not sure what I'm missing, but I'm struggling to find an official hg38 GTF file with RefSeq annotations. I'd like to provide ...
4
votes
2answers
103 views

Retrieving a list of human genes having GO associations

I need a command in R to retrieve all human genes associated with a Gene Ontology entry. I tried to look for it online but did not find it.
4
votes
1answer
339 views

Using BLAT command line tool to blat split sequences

I have the nucleotide sequence: AATTGAGGCACATTTTTTTTTAGACAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGGTGTGATCATAGCTCACTGCAGCCTCGACCTCCTGGGCTCAACAAAGCACACAGTGGGCGGATCCCCACCAG When I blat this on UCSC Genome ...
6
votes
5answers
608 views

What is the standard way to work with a diploid reference genome? Complementary strands?

At the moment, the standard reference genomes (e.g. hg19, hg38) are haploid genomes. We know that the human genome is diploid. Naturally, the latter would be the respectively correct representation of ...
3
votes
2answers
96 views

Dataset: Locations of regulatory sequences in the human genome?

I am looking for the positions of annotated regulatory sequences (promoters, enhancers and suppressors) in the human genome. I looked at Ensembl regulatory Build and PAZAR but I am not used to look ...
5
votes
1answer
763 views

How do I generate a variant list (i.e. VCF file) using Illumina reads from a human genome?

This is a problem I have to solve frequently, and I'd be interested in knowing what other methods people use to solve the same problem. About twice a year, I get asked to determine variants from ...
6
votes
1answer
168 views

Can a customized GRCh38 .gtf file be used with any of the GRCh38 released patches?

I got a customized GRCh38.79 .gtf file (modified to have no MT genes) and I need to create a reference genome out of it (for 10xGenomics CellRanger pipeline). I suspect that the .79 part is the ...
6
votes
1answer
78 views

State of the art in predicting Translation Initiation Sites

I'm working on a university project of predicting Translation Initiation Sites in human DNA. I searched the net for papers and documentation to get guidelines and inspiration, but I feel uncertain ...
11
votes
2answers
4k views

Downloading a reference Genome for Bowtie2

How do I download a reference genome that I can use with bowtie2? Specifically HG19. On UCSC there are a lot of file options.
8
votes
4answers
127 views

Working with old genome builds

Is working with and relying on old genome builds still valid? For example NCBI36/hg18. Would results from papers based on old builds require LiftOver and re-analysis to be useful? A bit of context, ...
16
votes
1answer
328 views

The state, limitations and comparisons of large variant stores

Background: We're increasingly needing some way of storing lots of variant data associated with lots of subjects: think clinical trials and hospital patients, looking for disease-causing or relevant ...
44
votes
8answers
3k views

What's the most efficient file format for the storage of DNA sequences?

I'd like to learn which format is most commonly used for storing the full human genome sequence (4 letters without a quality score) and why. I assume that storing it in plain-text format would be ...