Skip to main content

Questions tagged [illumina]

The tag has no usage guidance.

Filter by
Sorted by
Tagged with
1 vote
1 answer
15 views

Where to obtain fastq_illumina_filter

I'm setting up a snakemake pipeline for my lab, and I'd like to install fastq_illumina_filter. All links I can find point to this address for info on it, but the website seems to be down. Is there ...
Whitehot's user avatar
  • 372
1 vote
0 answers
15 views

Binning then assembling sequencing reads

I am attempting to do something similar to the "Phylomapping" pipeline described in this paper: https://www.nature.com/articles/s41559-019-0914-2. I have sets of Illumina PE reads, that I ...
JohnDoe23's user avatar
1 vote
2 answers
31 views

cellranger-arc throws an error when demultiplexing

I have a multiome dataset from a 10x run I'm trying to demultiplex using cellranger-arc mkfastq. The demultiplexing uses the ...
Assa Yeroslaviz's user avatar
5 votes
1 answer
75 views

Can index hopping lead to more reads in samples?

We run multiple samples for sequencing on an Illumina NovaSeq machine. After converting the files to fastq format using bcl2fastq, we can see that we have some ...
Assa Yeroslaviz's user avatar
0 votes
1 answer
28 views

Hybrid assembly versus polishing for hifi and illumina reads

I will have to carry out a project of assembly using hifi reads for which I have already illumina reads and I am wondering which of the hybrid assembly or polishing would be the best option for this ...
R-addict's user avatar
2 votes
1 answer
85 views

How do I quantify a specific somatic variant?

I'm working with targeted Illumina sequencing data generated with DNA from diseased and healthy tissue (this is an age-related disease and is not cancer/neoplastic). My hypothesis is that the diseased ...
Nereus's user avatar
  • 209
0 votes
0 answers
24 views

Aside from the header info, is there any way to distinguish between sequences generated by MiSeq and MiniSeq platforms?

I am comparing Illumina MiSeq (using MiSeq v3 kit) and MiniSeq (MiniSeq High Output kit) instruments for sequencing E.coli and Salmonella. I am curious if there is any way to bioinformatically ...
David's user avatar
  • 1
1 vote
0 answers
30 views

Illumina Final Report seemingly giving impossible genotypes; how do I make sense of this file? [closed]

I am working with an Illumina-generated final report file from human genotyping; the MEGA chip I believe. It's in a massive .csv file I've been 'exploring' via unix commands on a compute cluster, ...
KLN-RDN's user avatar
  • 21
2 votes
1 answer
28 views

Does using a microarray chip that matches the chip used in training lead to higher explained variance of a polygenic score?

I'm trying to replicate an existing polygenic score (i.e. test the accuracy in a new sample), and want to know if matching the original study's microarray chip will improve the accuracy (that is, ...
BigMistake's user avatar
1 vote
0 answers
41 views

Does pooled sample genotyping microarray analysis exist?

I want to genotype samples in small batches with a common microarray (e.g., the GSA). However, the cost is very high for small batches. With a higher sample throughput/volume, per sample cost becomes ...
BigMistake's user avatar
2 votes
1 answer
89 views

How to interpret a GenomeScope plot?

I am working on a new sponge genome and I have produced the genomescope plot from the 21-mer kmer frequencies. I have hard time interpreting the plot. Can someone please help me? Thank you.
Mudith Ekanayake's user avatar
3 votes
1 answer
253 views

Trimmomatic QC report shows drop in the reads and presence of overrepresented sequences

This question was also asked on Biostars I am performing a de novo genome assembly using Illumina paired-end short reads, sequenced on a NovaSeq X by our collaborator at UCLA. At present, I am in the ...
Vijith Kumar V's user avatar
4 votes
1 answer
49 views

How to get cytoband and gene level copy number from genome wide SNP array copy number data?

I have (human) Illumina genome wide SNP array copy number data. For each SNP genomewide, I have Log R Ratio (LRR) and B Allele Frequency (BAF). What tool(s) can I use to get the integer copy numbers (...
Sylvia Rodriguez's user avatar
2 votes
2 answers
86 views

paired-end short reads: will one file suffice?

I have a quick question about paired-end short reads. I have multiple genomes that were sequenced with paired-end Illumina NextSeq 200 technology, resulting in two fastq files per sample: ...
rimo's user avatar
  • 1,003
1 vote
0 answers
44 views

Journal article reference for Illumina's "near monopoly" [closed]

Apologies if the question is out of the scope of the bioinformatics SE. Please feel free to close it if it is the case. Recently, I have been going into a rabbit hole of papers that discuss the ...
Laura's user avatar
  • 11
1 vote
0 answers
83 views

Can files with different R1 and R2 lengths be trusted?

I received paired end amplicon sequence from a LAB with different lengths for R1 (320) and R2(280). Should I trust this lab to sequence other samples? Also, I had to do a trimming over the R2 at 220(...
abi's user avatar
  • 11
1 vote
1 answer
81 views

Singularity and Illumina's Nirvana

I am trying to using Illumina's Nirvana however I can't seem to get it to work despite having the right Singularity path. I pulled Nirvana down using ...
Indira's user avatar
  • 380
2 votes
0 answers
57 views

illuminaHumanv2.db returning NA for all Illumina probe ID to gene symbol conversion [closed]

This question has been cross-posted on Biostars but has not received any answers yet, so I'm posting it here. I'll update here if it gets answered there. I have downloaded a miRNA expression dataset ...
accibio's user avatar
  • 145
2 votes
1 answer
90 views

How do I measure the proportion of different bacteria in a sample from a high-throughput sequencer?

[this question is based on a question that was asked on Reddit] I have sequenced some [mostly cell-free] DNA from a sputum sample on a nanopore sequencing machine, and would like to know what is in it ...
gringer's user avatar
  • 14.3k
1 vote
1 answer
2k views

How much does Nanopore cDNA Sequencing Cost?

[this question is based on a question that was asked on Reddit] We're interested in doing whole-transcriptome cDNA sequencing of 24 mouse cell lines, and are deciding between Illumina and Nanopore ...
gringer's user avatar
  • 14.3k
1 vote
1 answer
34 views

what does ALT ID DUP refer to when ALT ID for copy number are already specified?

ALT ID CN2, CN3,CN4,CN5 are regions of elevated copy number relative to the reference, Then what does the ID =DUP separately cover? I am new to these analyses. please help ...
Anubrata Das's user avatar
4 votes
2 answers
180 views

relation between Illumina sequencing primer and viral sequences

Dealing whith a problematic sequencing run I found this over-represented sequence: GGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGGCGTCTTCTGCTTG It is clearly relate to the Illumina sequencing primer ...
mox's user avatar
  • 333
2 votes
2 answers
221 views

Improving prokaryotic assembly with other contig/scaffold-level data?

I have what at first sight appears to be a high-quality MAG (~10 pieces, high completion%) that I built from a hybrid assembly (Illumina + Nanopore data) from a cyanobacterium. Workflow: Quality ...
Laura's user avatar
  • 937
2 votes
2 answers
255 views

What should GC coverage bias plot of exome data look like?

I want to see if there is any GC coverage bias in some paired-end Illumina human exome data. Update This is for a variant calling project. I used the ...
Dandelion's user avatar
  • 353
2 votes
2 answers
134 views

What is the most accurate approach for de Novo sequencing?

I'm trying to decide between PacBio HiFi or Illumina sequencing platforms for sequencing the genome of aChrysina scarab. We want to identify the color pattern loci and also perform a phylogenetic ...
Caterina's user avatar
  • 307
1 vote
0 answers
30 views

Cromwell - controlling core/mem usage, and CallCaching, while running locally?

I'm sitting on a mountain of microarray (.idat files) data, and have been tasked to analyze it. I chose the MoChA pipeline, developed by the Broad Institute. It runs through Cromwell, of which I know ...
Joel's user avatar
  • 11
1 vote
0 answers
40 views

Creating msk file for Illumina Array Analysis CLI Copy number train

recently I'm researching on how to detect CNV from Illumina microarray data. I found that Illumina has Array Analysis CLI software for this task, and I need to train the CN model myself, since the ...
Thanh Nguyen's user avatar
2 votes
0 answers
58 views

open source tools for CNV analysis from illumina SNP array

What are the best open source tools to analyse copy number variation using Illumina SNP array data...preferably R based tools, but open to other languages as well. I'm working with leukemia sample and ...
newbiocoder's user avatar
3 votes
0 answers
32 views

Is there a generally accepted method used to impute missing DNA methylation data (probe beta-values)?

I'm looking at DNA methylation (DNAm) data such as TCGA (e.g., BRCA, KIRP, KIRC, etc.). Currently trying to build use my model to predict DNAm age on test sets, but many of the data sets are missing ...
sumthymes's user avatar
2 votes
1 answer
554 views

How to run MD5 check for multiple fastq files in different subdirectories?

I have received Illumina sequencing reads for 100 samples. I have 8 R1.fastq.gz and 8 R2.fastq.gz files for each sample in each ...
Anik Dutta's user avatar
0 votes
1 answer
455 views

Understand this Kmer plot from Merqury?

The attached figure is generated based on Illumina reads from multiple individuals compared to genome assembly. Looks like there are a lot of kmers are reads only (grey colored). Also, a blue peak (2x ...
Life_Searching_Steps's user avatar
1 vote
3 answers
554 views

Polishing PacBio or ONT with Illumina

Which tool would be good to polish PacBio or ONT with Illumina? Thank you in advance
user977828's user avatar
0 votes
1 answer
569 views

How to de novo hybrid assemble with Pacbio CCS and Illumina PE reads

I would like to perform de novo genome assembly on a diploid microalgal strain. I have two datasets: PacBio CCS/HiFi reads, low coverage. Illumina PE 2x150 (standard shotgun) Does anybody have any ...
bishopia's user avatar
0 votes
0 answers
146 views

Why is bcl2fastq2 taking so long to calculate stats?

Our lab has been using bcl2fastq v2.20.0.422 to demultiplex RNA-seq data sequenced on an Illumina Novaseq machine on a beefy EC2 instance and we've run into the strange problem: namely that while ...
divibisan's user avatar
  • 101
0 votes
0 answers
71 views

How to perform a meta-analysis using data consisting of paired-end and single-end reads generated from Illumina and Ion Torrent?

So basically I have RNA-seq reads that were generated from Illumina and Ion Torrent platforms for yeast species. I have seen an article where they compared liver cells of a rat that were sequenced ...
Justin1609's user avatar
1 vote
1 answer
1k views

What are some ways to error correct Oxford Nanopore long read sequencing?

I am sequencing long read genomic sequences to assemble MHC region haplotypes in a non model organism using Cas9 Sequencing Kit (SQK-CS9109) using flongle adaptors in the minION from Oxford Nanopore ...
mk894's user avatar
  • 105
0 votes
1 answer
73 views

Which format is the most raw format

I wanted information regarding which format is considered the most raw from an illumina sequencer ? fasta fastq bcl bam As per my research it should be bcl but I am not sure.
Monu Didi's user avatar
0 votes
1 answer
92 views

polidy VCF file for Canvas somatic-wgs cnv calling

I am trying to run Illumina CANVAS cnv caller for Somatic-WGS. There is an option "--ploidy-vcf" which is mandatory to supply, but don't know what exactly that mean. I had supplied the CNV....
Praveen's user avatar
  • 11
0 votes
1 answer
52 views

Modeling number of reads mapped to a gene

I am looking for a probability distribution of a number of reads mapped to a particular gene in metagenomic sequencing (NGS, shotgun, likely illumina). Naively one could model it via a binomial (or ...
Roger V.'s user avatar
  • 381
1 vote
1 answer
924 views

Error processing run file with bcl2fastq - Unable to open '.../RunInfo.xml' file for reading

I'm attempting to demux a nextseq run which I've successfully done several times in the past on other runs. I uploaded the run from my PC to the server (Ubuntu 18.04.4 LTS) without issue. Then I ran: <...
Stewart Russell's user avatar
2 votes
1 answer
62 views

Assembly reads having a copy of their beginning in their tail

I am analyzing the reads for the SARS-CoV-2 assembly with id SRR11140748. Apparently these reads were obtained with parallel sequencing by Illumina and Oxford Nanopore Technologies. I have found these ...
juanjo75es's user avatar
2 votes
1 answer
47 views

Total read count of shotgun affected by few highly abundant sequences

I am building statistical models to analyse output from Illumina shotgun sequencing (HiSeq 4000) on stool samples (but RNA-seq data should behave similarily). The raw counts are a statistical sample ...
Rene's user avatar
  • 21
3 votes
2 answers
2k views

How to demultiplex a mix of single-indexed and dual-indexed samples

The problem If I have a sample sheet that contains both single-indexed and dual-indexed samples, I can split it up into two sample sheets and then run bcl2fastq on each one. However, when doing this, ...
AmadeusDrZaius's user avatar
3 votes
0 answers
990 views

What could cause differing counts of R1 and R2 in Paired End Sequencing (RNASEQ)

I recently finished mapping an RNAseq run using STAR2.3.0 and noticed the read1 and read2 counts are different, according to samtools flagstat. The map% is ~80% but the R1 R2 counts are: R1=...
d_kennetz's user avatar
  • 631
4 votes
2 answers
167 views

How to predict stop codons in Illumina reads?

I have Illumina MiSeq paired-end reads from 150bp amplicons mapped to my reference genome (> 1000X coverage). These reads have indels that may or may not induce frameshifts. If the indel induces a ...
francoiskroll's user avatar
3 votes
2 answers
1k views

Is there a safe catch-all adapter sequence for trimming?

I would like to trim/mark adapters using trimmomatic or picard MarkIlluminaAdapters from a series of Illumina Paired-End read fastqs. The fastq files may have been done using different kits or ...
init_js's user avatar
  • 319
3 votes
3 answers
347 views

Tools for quality trimming at 5 prime?

I'm looking for a tool that is capable to do quality trimming at 5' end and it is configurable. For example, I can choose the quality trheshold, the read length, etc. Any recommendations? I'm ...
aLbAc's user avatar
  • 196
4 votes
2 answers
3k views

"Sequence Duplication Levels" module still fails after pre-processing Illumina data

I want to ask about why the sequence duplication levels are high after I trimmed by using Trimmomatic? I am using the following Trimmomatic operations: ...
yy97's user avatar
  • 43
4 votes
2 answers
476 views

How to align output of grep --color=always? (To QC fasta/fastq files)

Grepping out short sequences from a fasta or fastq file is a really useful way to look at sequencing data. Using the option --color=always makes this even more ...
conchoecia's user avatar
  • 3,181
2 votes
1 answer
1k views

Why are there more barcodes than GEMs in 10X chromium data?

Question: Why are there more barcodes than GEMs in 10X chromium data? Introduction I have several 10X genomics chromium libraries made with the de novo assembly/genome protocol. The 10X chromium ...
conchoecia's user avatar
  • 3,181