Questions tagged [multiple-sequence-alignment]

Filter by
Sorted by
Tagged with
0
votes
0answers
11 views

Generating sequences from HMM

I encountered this question in a textbook (source: https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.721.2540&rep=rep1&type=pdf) and was trying to workout the solution for it. Was ...
0
votes
0answers
30 views

Fastest way to count where two bam files are homozygote reference (inverted variant calling)

Maybe I'm having a brain-freeze so excuse me if this is a waste of everyone's time... I am working with an organism with ~700Mb genome. I have bam files of two individuals that are whole genome ...
1
vote
0answers
24 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
2
votes
0answers
25 views

How to get phylogenetic tree from multiple genes?

I constructed a phylogenetic tree using a gene (example - secA). I had to gather the same gene sequence for all the required species from public database-NCBI and then constructed the tree after ...
0
votes
0answers
44 views

Splitting .bam files into separate samples for tophat2

I have RNA seq data of 12 samples (paired end, so 24 files) and I ran tophat2 for alignment on all of them which gave me one bam file for all the samples. Now I need separate bam files for all the ...
0
votes
2answers
44 views

Remove from Multi-FASTA by Sequence ID

I want to remove sequence VRE32514 – it doesn’t belong and thus is the reason it lacks additional metadata. However I tried implementing this code from a similar question: ...
0
votes
1answer
16 views

BEAUti not accepting taxa tip dates

I'm using BEAUti as part of my pipeline and the sequence names include | to separate the metadata fields - with culture date being at the very end. When I attempt ...
1
vote
2answers
32 views

Getting exact mismatch data from multiple sequence alignment

TL;DR Can anyone point me in the direction of a tool that can be used to input different viral substrain reference sequences (fasta) as well as sequence data (fastq/bam/vcf) and find the most likely ...
2
votes
1answer
82 views

How do I plot clusters based on DNA sequence alignment?

I have a group of about 1050 sequences that have been aligned using blastn. I am now trying to create a cluster plot of the sequences in order to identify similar sequences, something like this: ...
1
vote
1answer
40 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
1
vote
1answer
43 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
2
votes
0answers
42 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
1
vote
2answers
41 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
1
vote
0answers
27 views

Call NCBI Multiple Sequence Alignment Viewer with target URL?

I am storing a sequence aligment file on a webserver and now would like to visualize the results. I used the NCBI Multiple Sequence Alignment Viewer . The issue is that there are several manual steps ...