Questions tagged [multiple-sequence-alignment]

Filter by
Sorted by
Tagged with
4 votes
3 answers
76 views

multi-sequence alignment of samples with multiple contigs each

I want to perform a multi-sequence alignment on 12 samples that clustered based on cgMLST. Ultimate goal is to find out whether they differ by the presence of a few genes. I have performed multi-...
user avatar
  • 233
1 vote
2 answers
33 views

Generate consensus protein sequence from relatively gappy alignment?

I would like to know what would be the best way to generate a full-length consensus sequence? I want to obtain a single representative sequence from a relatively gappy multiple sequence alignment of ...
user avatar
  • 2,234
2 votes
1 answer
88 views

Sequence alignment with MUSCLE

For protein multiple sequence alignment (MSA), I am using MUSCLE (v5.1). The default setting without any specifications gives a 'bad' output even though my proteins are very similar (UniProt sequence ...
user avatar
-1 votes
2 answers
66 views

ClustalOmega alignment

I am performing multiple sequence alignment using Clustal Omega for 600 RNA covid-sequences, i.e. cDNA on Genbank, with input characters around 30574 characters for each sequence. I am running it on ...
user avatar
2 votes
2 answers
62 views

How to make MSA for contact prediction?

I'd like to try a contact prediction method (like TripletRes, CCMpred etc) using a custom set of sequences. There are about 1.5M sequences, all very similar to the canonical sequence; their ...
user avatar
  • 121
1 vote
4 answers
222 views

Remove gaps from alignment?

I have an MSA (protein sequence) and I have used various programmes (Clustal, Aliview, MEGA11 etc) to align. However, in all programmes I get many gaps which is not ideal as I am trying to construct a ...
user avatar
  • 85
0 votes
1 answer
26 views

find conservative regions relative to a specific accession

I have 7 RefSeq accessions which I performed multiple sequence aligment on it using CLUSTALO....
user avatar
  • 111
0 votes
2 answers
52 views

Use biopython to align SeqRecords stored in dict

I'd like to perform multiple alignments, where a gene from each sample was read in from fasta files. The fasta file represented one sample and had multiple genes. I have read in each sample fasta file ...
user avatar
0 votes
0 answers
18 views

Type and number of gaps in sequence alignments

I used Kalign and Muscle to align given sequences, the results are presented below. My question is, based on the two alignments which tool seems better? I would personally believe that the Muscle tool ...
user avatar
  • 103
1 vote
2 answers
78 views

Multiple Sequence Alignment

I applied three multiple sequence alignment methods of muscle, mafft and clistal omega on 30 sequences and 400 sequences . In the case of 30 seq, the output of alignment from the 3 methods was in the ...
user avatar
1 vote
1 answer
101 views

Generating sequences from HMM

I encountered this question in a textbook (source: https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.721.2540&rep=rep1&type=pdf) and was trying to workout the solution for it. Was ...
user avatar
0 votes
0 answers
33 views

Fastest way to count where two bam files are homozygote reference (inverted variant calling)

Maybe I'm having a brain-freeze so excuse me if this is a waste of everyone's time... I am working with an organism with ~700Mb genome. I have bam files of two individuals that are whole genome ...
user avatar
  • 121
2 votes
0 answers
26 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
user avatar
  • 145
4 votes
0 answers
70 views

How to get phylogenetic tree from multiple genes?

I constructed a phylogenetic tree using a gene (example - secA). I had to gather the same gene sequence for all the required species from public database-NCBI and then constructed the tree after ...
user avatar
  • 73
0 votes
0 answers
106 views

Splitting .bam files into separate samples for tophat2

I have RNA seq data of 12 samples (paired end, so 24 files) and I ran tophat2 for alignment on all of them which gave me one bam file for all the samples. Now I need separate bam files for all the ...
user avatar
0 votes
2 answers
136 views

Remove from Multi-FASTA by Sequence ID

I want to remove sequence VRE32514 – it doesn’t belong and thus is the reason it lacks additional metadata. However I tried implementing this code from a similar question: ...
user avatar
1 vote
1 answer
21 views

BEAUti not accepting taxa tip dates

I'm using BEAUti as part of my pipeline and the sequence names include | to separate the metadata fields - with culture date being at the very end. When I attempt ...
user avatar
1 vote
2 answers
51 views

Getting exact mismatch data from multiple sequence alignment

TL;DR Can anyone point me in the direction of a tool that can be used to input different viral substrain reference sequences (fasta) as well as sequence data (fastq/bam/vcf) and find the most likely ...
user avatar
  • 21
2 votes
1 answer
183 views

How do I plot clusters based on DNA sequence alignment?

I have a group of about 1050 sequences that have been aligned using blastn. I am now trying to create a cluster plot of the sequences in order to identify similar sequences, something like this: ...
user avatar
  • 23
1 vote
1 answer
55 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
user avatar
  • 149
1 vote
1 answer
77 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
user avatar
  • 149
2 votes
0 answers
51 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
user avatar
  • 41
1 vote
2 answers
50 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interest in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
user avatar
  • 149
1 vote
0 answers
28 views

Call NCBI Multiple Sequence Alignment Viewer with target URL?

I am storing a sequence aligment file on a webserver and now would like to visualize the results. I used the NCBI Multiple Sequence Alignment Viewer . The issue is that there are several manual steps ...
user avatar
  • 1,181