Questions tagged [multiple-sequence-alignment]

Filter by
Sorted by
Tagged with
3 votes
1 answer
65 views

What is the best way to acquire protein isoform sequence alignment?

[Update] Thanks @terdon. To clarify my question: I have a bunch of protein isoforms sequences (produced by the transcripts in the figure) and I want to align protein products (e.g., proteins produced ...
Jen Marylin's user avatar
0 votes
1 answer
99 views

Aligning sequences with multiple genetic codes!

I am doing a project on duplicated genes and I have a major difficulty on how to align sequences that use different genetic codes. I work with fasta files that contain sequences of protein coding ...
George X.'s user avatar
4 votes
2 answers
171 views

BioPython bootstrap is not reliable?

Here i will show you a minimal working example of code and as you can see the support values for the tree is always 100. I am using synthetic sequences of 100bp for 6 elements. The sequences have been ...
Mirko's user avatar
  • 247
0 votes
1 answer
24 views

Current 'most comprehensive' whole genome alignment resource for human?

I found the human genome alignment sets here: https://www.ensembl.org/info/genome/compara/multiple_genome_alignments.html but they doesn't include, for example, ancient human genomes, e.g. those here: ...
Dan Bolser's user avatar
4 votes
2 answers
108 views

How to create a phylogenetic tree from diverse mitochondrial genomes

I would like to create a phylogenetic tree for the most species in my dataset. I'm starting with around 1200 species, but since it's not good practice to align short and long sequences I tried ...
Mirko's user avatar
  • 247
1 vote
0 answers
58 views

SNP How to detect regions of erratic pairwise alignment?

I have clusters of DNA sequences that contain some mutations. All the sequences in a cluster should contain the same mutations. As the mutations aren't known, those clusters of sequences were pairwise-...
Fravadona's user avatar
  • 181
0 votes
1 answer
56 views

Mapping List of Probes/Primers/Short Oligos to a Reference Fasta/q

Could you help me bioinformatics SE people. So I have been duckduckgo-ing up a storm and even consulted the AI overlords and haven't come up with a solid way to do this, but it is so fundamental to ...
RPINerd's user avatar
  • 51
0 votes
1 answer
97 views

How to highlight the specific peptide sequences after performing multiple sequence alignment for the fasta file?

I have the peptide sequences and fasta files separately. I first aligned the fasta files using msa package. After that I'm trying to highlight the peptide sequences ...
Lazy PhD's user avatar
3 votes
3 answers
231 views

Read Clustal file in Python

This question was also asked on StackOverflow I have a multiple sequence alignment (MSA) file derived from mafft in clustal format which I want to import into Python and save into a PDF file. I need ...
Denise Lavezzari's user avatar
1 vote
1 answer
87 views

How to identify sequence origin in DNA shuffle reads?

The data I have a large number of reads from sequences that were generated by randomly shuffling regions of two parent sequences together. See the following image: The regions that are shuffled are ...
Yano's user avatar
  • 13
1 vote
0 answers
71 views

difficult in runing the R code for ggtree

I tried to run the below code but ended having issue. I have checked thoroughly and I didn't find any mismatch in fasta sequence ...
Manasa K.G.'s user avatar
2 votes
1 answer
156 views

drawing multiple sequence alignment as tree in R

I am very new here. Please help me with my codes as am trying to draw multiple sequence alignment as tree suing ggtree package in R and i have following error. ...
Manasa K.G.'s user avatar
3 votes
2 answers
181 views

Select representetive sequence within MSA (protein)

I am trying to pick the best representative sequence from an amino acid MSA. I do not want to use the consensus, as it generates an artificial one. Here is my approach: I calculate a Percentage ...
Nilay Lale's user avatar
6 votes
4 answers
914 views

multi-sequence alignment of samples with multiple contigs each

I want to perform a multi-sequence alignment on 12 samples that clustered based on cgMLST. Ultimate goal is to find out whether they differ by the presence of a few genes. I have performed multi-...
BCArg's user avatar
  • 283
1 vote
2 answers
83 views

Generate consensus protein sequence from relatively gappy alignment?

I would like to know what would be the best way to generate a full-length consensus sequence? I want to obtain a single representative sequence from a relatively gappy multiple sequence alignment of ...
719016's user avatar
  • 2,324
2 votes
1 answer
326 views

Sequence alignment with MUSCLE

For protein multiple sequence alignment (MSA), I am using MUSCLE (v5.1). The default setting without any specifications gives a 'bad' output even though my proteins are very similar (UniProt sequence ...
Balint Biro's user avatar
-1 votes
2 answers
130 views

ClustalOmega alignment

I am performing multiple sequence alignment using Clustal Omega for 600 RNA covid-sequences, i.e. cDNA on Genbank, with input characters around 30574 characters for each sequence. I am running it on ...
Radwa Elawadi's user avatar
2 votes
2 answers
129 views

How to make MSA for contact prediction?

I'd like to try a contact prediction method (like TripletRes, CCMpred etc) using a custom set of sequences. There are about 1.5M sequences, all very similar to the canonical sequence; their ...
Alex I's user avatar
  • 121
1 vote
4 answers
1k views

Remove gaps from alignment?

I have an MSA (protein sequence) and I have used various programmes (Clustal, Aliview, MEGA11 etc) to align. However, in all programmes I get many gaps which is not ideal as I am trying to construct a ...
mk894's user avatar
  • 95
0 votes
1 answer
37 views

find conservative regions relative to a specific accession

I have 7 RefSeq accessions which I performed multiple sequence aligment on it using CLUSTALO....
moth's user avatar
  • 111
0 votes
2 answers
80 views

Use biopython to align SeqRecords stored in dict

I'd like to perform multiple alignments, where a gene from each sample was read in from fasta files. The fasta file represented one sample and had multiple genes. I have read in each sample fasta file ...
Glubbdrubb's user avatar
1 vote
2 answers
151 views

Multiple Sequence Alignment

I applied three multiple sequence alignment methods of muscle, mafft and clistal omega on 30 sequences and 400 sequences . In the case of 30 seq, the output of alignment from the 3 methods was in the ...
Radwa Elawadi's user avatar
1 vote
1 answer
127 views

Generating sequences from HMM

I encountered this question in a textbook (source: https://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.721.2540&rep=rep1&type=pdf) and was trying to workout the solution for it. Was ...
xxxcompbioxxx's user avatar
0 votes
0 answers
34 views

Fastest way to count where two bam files are homozygote reference (inverted variant calling)

Maybe I'm having a brain-freeze so excuse me if this is a waste of everyone's time... I am working with an organism with ~700Mb genome. I have bam files of two individuals that are whole genome ...
AWE's user avatar
  • 121
2 votes
0 answers
31 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
iamakhilverma's user avatar
4 votes
0 answers
222 views

How to get phylogenetic tree from multiple genes?

I constructed a phylogenetic tree using a gene (example - secA). I had to gather the same gene sequence for all the required species from public database-NCBI and then constructed the tree after ...
abelfit's user avatar
  • 73
0 votes
0 answers
154 views

Splitting .bam files into separate samples for tophat2

I have RNA seq data of 12 samples (paired end, so 24 files) and I ran tophat2 for alignment on all of them which gave me one bam file for all the samples. Now I need separate bam files for all the ...
Dixi Modi's user avatar
0 votes
2 answers
452 views

Remove from Multi-FASTA by Sequence ID

I want to remove sequence VRE32514 – it doesn’t belong and thus is the reason it lacks additional metadata. However I tried implementing this code from a similar question: ...
MicroBiostat's user avatar
1 vote
1 answer
45 views

BEAUti not accepting taxa tip dates

I'm using BEAUti as part of my pipeline and the sequence names include | to separate the metadata fields - with culture date being at the very end. When I attempt ...
MicroBiostat's user avatar
1 vote
2 answers
181 views

Getting exact mismatch data from multiple sequence alignment

TL;DR Can anyone point me in the direction of a tool that can be used to input different viral substrain reference sequences (fasta) as well as sequence data (fastq/bam/vcf) and find the most likely ...
KasperH's user avatar
  • 21
2 votes
1 answer
591 views

How do I plot clusters based on DNA sequence alignment?

I have a group of about 1050 sequences that have been aligned using blastn. I am now trying to create a cluster plot of the sequences in order to identify similar sequences, something like this: ...
Widget's user avatar
  • 23
1 vote
1 answer
97 views

File format of substitution matrix in clustalw

I need to set the substitution matrix used by command line CLUSTALW when comparing DNA sequences to: 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 -1 -1 -1 -1 0 from my ...
gcorso's user avatar
  • 159
1 vote
1 answer
143 views

Median string problem & multiple sequence alignment

I read about the median string problem as an introduction to the multiple sequence alignment, however none of the MSA algorithms used seems to be using the idea of finding the median string. To my ...
gcorso's user avatar
  • 159
2 votes
0 answers
66 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
GSQ's user avatar
  • 41
2 votes
2 answers
86 views

Multiple Alignment cost application

Is there any biological application/case where someone would be interested in the estimated total cost of the alignment between a set of sequences (genes or amino acids) without the aligned sequence ...
gcorso's user avatar
  • 159
1 vote
0 answers
29 views

Call NCBI Multiple Sequence Alignment Viewer with target URL?

I am storing a sequence aligment file on a webserver and now would like to visualize the results. I used the NCBI Multiple Sequence Alignment Viewer . The issue is that there are several manual steps ...
Soerendip's user avatar
  • 1,295