Skip to main content

Questions tagged [multiple-sequence-alignment]

12 questions with no upvoted or accepted answers
Filter by
Sorted by
Tagged with
4 votes
0 answers
239 views

How to get phylogenetic tree from multiple genes?

I constructed a phylogenetic tree using a gene (example - secA). I had to gather the same gene sequence for all the required species from public database-NCBI and then constructed the tree after ...
abelfit's user avatar
  • 73
2 votes
0 answers
40 views

How to create a dataset of contact maps of homologous proteins?

Disclaimer: I am a machine learning researcher working on network science and want to use proteins to test an algorithm of mine using real-world data. My bioinformatics knowledge is minimal. I need to ...
Tendero's user avatar
  • 121
2 votes
0 answers
32 views

Alignment with inserts and keeping the indexing of ref seq intact

Parts of sequences are given below- Reference sequence (pre-alignment): ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGT ...
iamakhilverma's user avatar
2 votes
0 answers
68 views

Why do I obtain different output results with blast vs awk commands

I have an awk command that identifies 30 pb from two multifasta files. When I used two input files: E.g. 100 sequences each, I get the same result with the ...
GSQ's user avatar
  • 41
1 vote
0 answers
37 views

Need to find an intersect of sequences inside fasta files (no standardized sequence names)

I have several multifasta files (each containing between 3,000 to 3,600 sequences). The sequence names were derived from the genome where the sequence was extracted and they bear no significance or ...
Miguel Prieto's user avatar
1 vote
0 answers
59 views

SNP How to detect regions of erratic pairwise alignment?

I have clusters of DNA sequences that contain some mutations. All the sequences in a cluster should contain the same mutations. As the mutations aren't known, those clusters of sequences were pairwise-...
Fravadona's user avatar
  • 181
1 vote
0 answers
81 views

difficult in runing the R code for ggtree

I tried to run the below code but ended having issue. I have checked thoroughly and I didn't find any mismatch in fasta sequence ...
Manasa K.G.'s user avatar
1 vote
0 answers
29 views

Call NCBI Multiple Sequence Alignment Viewer with target URL?

I am storing a sequence aligment file on a webserver and now would like to visualize the results. I used the NCBI Multiple Sequence Alignment Viewer . The issue is that there are several manual steps ...
Soerendip's user avatar
  • 1,295
0 votes
1 answer
106 views

Aligning sequences with multiple genetic codes!

I am doing a project on duplicated genes and I have a major difficulty on how to align sequences that use different genetic codes. I work with fasta files that contain sequences of protein coding ...
George X.'s user avatar
0 votes
1 answer
81 views

Mapping List of Probes/Primers/Short Oligos to a Reference Fasta/q

Could you help me bioinformatics SE people. So I have been duckduckgo-ing up a storm and even consulted the AI overlords and haven't come up with a solid way to do this, but it is so fundamental to ...
RPINerd's user avatar
  • 51
0 votes
0 answers
36 views

Fastest way to count where two bam files are homozygote reference (inverted variant calling)

Maybe I'm having a brain-freeze so excuse me if this is a waste of everyone's time... I am working with an organism with ~700Mb genome. I have bam files of two individuals that are whole genome ...
AWE's user avatar
  • 121
0 votes
0 answers
163 views

Splitting .bam files into separate samples for tophat2

I have RNA seq data of 12 samples (paired end, so 24 files) and I ran tophat2 for alignment on all of them which gave me one bam file for all the samples. Now I need separate bam files for all the ...
Dixi Modi's user avatar